ID: 1195292967

View in Genome Browser
Species Human (GRCh38)
Location X:103446881-103446903
Sequence CCATCACTACACAGAGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195292967_1195292971 24 Left 1195292967 X:103446881-103446903 CCTCGGTCTCTGTGTAGTGATGG No data
Right 1195292971 X:103446928-103446950 GCAAGCAAAACTCCTGACAATGG No data
1195292967_1195292972 25 Left 1195292967 X:103446881-103446903 CCTCGGTCTCTGTGTAGTGATGG No data
Right 1195292972 X:103446929-103446951 CAAGCAAAACTCCTGACAATGGG No data
1195292967_1195292973 26 Left 1195292967 X:103446881-103446903 CCTCGGTCTCTGTGTAGTGATGG No data
Right 1195292973 X:103446930-103446952 AAGCAAAACTCCTGACAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195292967 Original CRISPR CCATCACTACACAGAGACCG AGG (reversed) Intergenic
No off target data available for this crispr