ID: 1195295210

View in Genome Browser
Species Human (GRCh38)
Location X:103469868-103469890
Sequence TTGAGGCTGGTCCTCAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195295210_1195295222 17 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295222 X:103469908-103469930 CCAAAGTCCGGTGGCGATGAAGG No data
1195295210_1195295217 5 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG No data
1195295210_1195295219 8 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295219 X:103469899-103469921 GTAGGGTACCCAAAGTCCGGTGG No data
1195295210_1195295212 -10 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295212 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data
1195295210_1195295213 -9 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295213 X:103469882-103469904 CAGCCTCAACACCACCCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195295210 Original CRISPR TTGAGGCTGGTCCTCAACAG AGG (reversed) Intergenic