ID: 1195295211

View in Genome Browser
Species Human (GRCh38)
Location X:103469881-103469903
Sequence CCTACGGGTGGTGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195295211_1195295224 20 Left 1195295211 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data
Right 1195295224 X:103469924-103469946 ATGAAGGAATGAGAAGAGACAGG No data
1195295211_1195295222 4 Left 1195295211 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data
Right 1195295222 X:103469908-103469930 CCAAAGTCCGGTGGCGATGAAGG No data
1195295211_1195295217 -8 Left 1195295211 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data
Right 1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG No data
1195295211_1195295219 -5 Left 1195295211 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data
Right 1195295219 X:103469899-103469921 GTAGGGTACCCAAAGTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195295211 Original CRISPR CCTACGGGTGGTGTTGAGGC TGG (reversed) Intergenic