ID: 1195295212

View in Genome Browser
Species Human (GRCh38)
Location X:103469881-103469903
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195295210_1195295212 -10 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295212 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195295212 Original CRISPR CCAGCCTCAACACCACCCGT AGG Intergenic