ID: 1195295213 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:103469882-103469904 |
| Sequence | CAGCCTCAACACCACCCGTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195295210_1195295213 | -9 | Left | 1195295210 | X:103469868-103469890 | CCTCTGTTGAGGACCAGCCTCAA | No data | ||
| Right | 1195295213 | X:103469882-103469904 | CAGCCTCAACACCACCCGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195295213 | Original CRISPR | CAGCCTCAACACCACCCGTA GGG | Intergenic | ||