ID: 1195295213

View in Genome Browser
Species Human (GRCh38)
Location X:103469882-103469904
Sequence CAGCCTCAACACCACCCGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195295210_1195295213 -9 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295213 X:103469882-103469904 CAGCCTCAACACCACCCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195295213 Original CRISPR CAGCCTCAACACCACCCGTA GGG Intergenic