ID: 1195295214 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:103469885-103469907 |
| Sequence | GTACCCTACGGGTGGTGTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195295214_1195295224 | 16 | Left | 1195295214 | X:103469885-103469907 | CCTCAACACCACCCGTAGGGTAC | No data | ||
| Right | 1195295224 | X:103469924-103469946 | ATGAAGGAATGAGAAGAGACAGG | No data | ||||
| 1195295214_1195295219 | -9 | Left | 1195295214 | X:103469885-103469907 | CCTCAACACCACCCGTAGGGTAC | No data | ||
| Right | 1195295219 | X:103469899-103469921 | GTAGGGTACCCAAAGTCCGGTGG | No data | ||||
| 1195295214_1195295222 | 0 | Left | 1195295214 | X:103469885-103469907 | CCTCAACACCACCCGTAGGGTAC | No data | ||
| Right | 1195295222 | X:103469908-103469930 | CCAAAGTCCGGTGGCGATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195295214 | Original CRISPR | GTACCCTACGGGTGGTGTTG AGG (reversed) | Intergenic | ||