ID: 1195295217

View in Genome Browser
Species Human (GRCh38)
Location X:103469896-103469918
Sequence CCCGTAGGGTACCCAAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195295210_1195295217 5 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG No data
1195295211_1195295217 -8 Left 1195295211 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data
Right 1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195295217 Original CRISPR CCCGTAGGGTACCCAAAGTC CGG Intergenic