ID: 1195295222

View in Genome Browser
Species Human (GRCh38)
Location X:103469908-103469930
Sequence CCAAAGTCCGGTGGCGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195295215_1195295222 -8 Left 1195295215 X:103469893-103469915 CCACCCGTAGGGTACCCAAAGTC No data
Right 1195295222 X:103469908-103469930 CCAAAGTCCGGTGGCGATGAAGG No data
1195295210_1195295222 17 Left 1195295210 X:103469868-103469890 CCTCTGTTGAGGACCAGCCTCAA No data
Right 1195295222 X:103469908-103469930 CCAAAGTCCGGTGGCGATGAAGG No data
1195295214_1195295222 0 Left 1195295214 X:103469885-103469907 CCTCAACACCACCCGTAGGGTAC No data
Right 1195295222 X:103469908-103469930 CCAAAGTCCGGTGGCGATGAAGG No data
1195295211_1195295222 4 Left 1195295211 X:103469881-103469903 CCAGCCTCAACACCACCCGTAGG No data
Right 1195295222 X:103469908-103469930 CCAAAGTCCGGTGGCGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195295222 Original CRISPR CCAAAGTCCGGTGGCGATGA AGG Intergenic