ID: 1195300339

View in Genome Browser
Species Human (GRCh38)
Location X:103524160-103524182
Sequence TAAGAAAGCACAGTGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195300339_1195300344 14 Left 1195300339 X:103524160-103524182 CCAGCAATCACTGTGCTTTCTTA No data
Right 1195300344 X:103524197-103524219 CAGGAACCATCTTAGGCACTGGG No data
1195300339_1195300341 7 Left 1195300339 X:103524160-103524182 CCAGCAATCACTGTGCTTTCTTA No data
Right 1195300341 X:103524190-103524212 AGTGTGCCAGGAACCATCTTAGG No data
1195300339_1195300340 -5 Left 1195300339 X:103524160-103524182 CCAGCAATCACTGTGCTTTCTTA No data
Right 1195300340 X:103524178-103524200 TCTTAGAGTAACAGTGTGCCAGG No data
1195300339_1195300343 13 Left 1195300339 X:103524160-103524182 CCAGCAATCACTGTGCTTTCTTA No data
Right 1195300343 X:103524196-103524218 CCAGGAACCATCTTAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195300339 Original CRISPR TAAGAAAGCACAGTGATTGC TGG (reversed) Intergenic
No off target data available for this crispr