ID: 1195304351

View in Genome Browser
Species Human (GRCh38)
Location X:103564901-103564923
Sequence GTATGTACACAGGTTTAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195304351_1195304355 26 Left 1195304351 X:103564901-103564923 CCTAGTTAAACCTGTGTACATAC No data
Right 1195304355 X:103564950-103564972 TTACTAAATTATAGATGTTTAGG No data
1195304351_1195304353 1 Left 1195304351 X:103564901-103564923 CCTAGTTAAACCTGTGTACATAC No data
Right 1195304353 X:103564925-103564947 TCTGTAAAATATTTCCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195304351 Original CRISPR GTATGTACACAGGTTTAACT AGG (reversed) Intergenic
No off target data available for this crispr