ID: 1195304351 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:103564901-103564923 |
| Sequence | GTATGTACACAGGTTTAACT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195304351_1195304355 | 26 | Left | 1195304351 | X:103564901-103564923 | CCTAGTTAAACCTGTGTACATAC | No data | ||
| Right | 1195304355 | X:103564950-103564972 | TTACTAAATTATAGATGTTTAGG | No data | ||||
| 1195304351_1195304353 | 1 | Left | 1195304351 | X:103564901-103564923 | CCTAGTTAAACCTGTGTACATAC | No data | ||
| Right | 1195304353 | X:103564925-103564947 | TCTGTAAAATATTTCCTATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195304351 | Original CRISPR | GTATGTACACAGGTTTAACT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||