ID: 1195308867

View in Genome Browser
Species Human (GRCh38)
Location X:103610571-103610593
Sequence TTAAGTGTCTGACAGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195308867_1195308870 -8 Left 1195308867 X:103610571-103610593 CCAGCACCCTGTCAGACACTTAA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1195308870 X:103610586-103610608 ACACTTAAAAGAAGAGCTGAAGG 0: 1
1: 0
2: 3
3: 27
4: 320
1195308867_1195308872 13 Left 1195308867 X:103610571-103610593 CCAGCACCCTGTCAGACACTTAA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1195308872 X:103610607-103610629 GGTAGGTTTCACCTGTCCCCAGG 0: 1
1: 0
2: 1
3: 6
4: 120
1195308867_1195308871 -4 Left 1195308867 X:103610571-103610593 CCAGCACCCTGTCAGACACTTAA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1195308871 X:103610590-103610612 TTAAAAGAAGAGCTGAAGGTAGG 0: 1
1: 0
2: 1
3: 36
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195308867 Original CRISPR TTAAGTGTCTGACAGGGTGC TGG (reversed) Intronic
909358560 1:74735702-74735724 TTACGTATCTGACATTGTGCTGG - Intronic
910704109 1:90108222-90108244 TTAAAAGTCTGACAGGATGGGGG + Intergenic
913104139 1:115596029-115596051 AGAGCTGTCTGACAGGGTGCAGG - Intergenic
915175853 1:154014219-154014241 TTAAGTGTCAGGCATTGTGCTGG - Intronic
916377689 1:164173372-164173394 GTAAGTGTTTAACAGGCTGCTGG - Intergenic
916499363 1:165373738-165373760 TTATCTGTTTCACAGGGTGCTGG + Intergenic
920332521 1:205220524-205220546 TTATATCTCTCACAGGGTGCTGG - Intergenic
921079726 1:211729415-211729437 TTCAGTTTCTTACAGGCTGCTGG + Intergenic
922452444 1:225747842-225747864 GTAAGGGTCAGGCAGGGTGCCGG - Intergenic
922599027 1:226835770-226835792 TGAAGTGTCTGTGATGGTGCAGG - Intergenic
924027936 1:239856718-239856740 TTACGTGTCAGACATTGTGCTGG - Intronic
1064704271 10:18055627-18055649 TACAGTGTCTTACAGAGTGCTGG - Intergenic
1068832140 10:61507562-61507584 TTCAGTGCCAGACAGGGTGCAGG - Intergenic
1069715544 10:70518830-70518852 TCATGTGTCTGCCAGGGGGCAGG - Intronic
1070609720 10:77925452-77925474 GTAAGTGTGTGTCTGGGTGCAGG - Intronic
1070641466 10:78173480-78173502 TCAAGTGTCTGCAAGGGAGCCGG - Intergenic
1072973816 10:100040381-100040403 TTTGGTATCTGAGAGGGTGCTGG + Intergenic
1074415884 10:113266226-113266248 TTAAGTTTCTGAGGGGTTGCAGG + Intergenic
1076931147 10:133532775-133532797 GTATGTGTCTGAAAGGGTGAAGG + Exonic
1077989031 11:7385397-7385419 TTAAATGTCTGACAGAGTTTGGG - Intronic
1081033152 11:38112084-38112106 TTAACTGGCTGACAGGGGCCCGG - Intergenic
1084031675 11:66484884-66484906 TCAGGTGGCTGAGAGGGTGCTGG + Intronic
1087738810 11:101864309-101864331 TTCAGTGTATGACAGGCTGCTGG - Intronic
1092489341 12:8930897-8930919 ATAAGTGTCTGGCTGGGCGCAGG - Exonic
1095430976 12:42134251-42134273 TGCAGTTTCTGACAGGGTCCAGG - Intronic
1096597535 12:52706193-52706215 TTAAGTGTCTGAGAGGCTCTAGG - Intergenic
1096946451 12:55413640-55413662 ATAAGTGTCTGGCTGGGCGCAGG + Intergenic
1097572077 12:61346434-61346456 TTCAGTGTCAGACACTGTGCTGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099470547 12:83042649-83042671 ATGACTGTCTGACAGGGTGTGGG - Intronic
1099885943 12:88530569-88530591 TCAAGTGTCTGCCAAAGTGCTGG + Intronic
1100265855 12:92975175-92975197 TCCAGTGGCTGACAGGCTGCTGG + Intergenic
1102684885 12:114717022-114717044 TTAAGTGTTTCACATAGTGCTGG - Intergenic
1102708510 12:114904430-114904452 GTAAGTGTGTGAAAGTGTGCGGG + Intergenic
1103237828 12:119388464-119388486 TTAAGTTTCTGCCAGTGTGATGG + Intronic
1107967946 13:45614392-45614414 CTACGTGCCTGACATGGTGCCGG - Intronic
1110212908 13:72993848-72993870 TTAATGTTCTGAGAGGGTGCTGG - Intronic
1115455217 14:33594118-33594140 TTTAGTATCTGAAAGGGTCCTGG - Intronic
1116326129 14:43535401-43535423 TTAAGTGGCTGACAGGTGCCCGG - Intergenic
1118105904 14:62659263-62659285 TTAAGTGTCTGATAAGGACCTGG - Intergenic
1119434507 14:74589223-74589245 TTCCGTGTCAGACAGTGTGCTGG - Intronic
1122098575 14:99389312-99389334 TCAAGTGTCTGGCCGGGTCCAGG + Intergenic
1126678825 15:51184867-51184889 TTAAGTGTCTGTCTGAGTGTGGG + Intergenic
1127267841 15:57376072-57376094 TTAAGTTTCTGACAGTGAGGGGG + Intronic
1127646700 15:60965819-60965841 ATAAGTGTGAGACAGGGTGAAGG - Intronic
1128567028 15:68707823-68707845 GGAAGTGACTGAGAGGGTGCAGG - Intronic
1131533758 15:93216585-93216607 TTAGGGGTCTGAGAGGGTGAGGG - Intergenic
1131680919 15:94722230-94722252 TAATGTGTCAGACAGTGTGCTGG - Intergenic
1133499596 16:6353488-6353510 TTAAGTGTAGGGCATGGTGCTGG + Intronic
1133897050 16:9939715-9939737 TTGAGTGTCAGAAAGGGGGCAGG - Intronic
1138252543 16:55513717-55513739 TCTAGTGGCTGACAGGTTGCTGG - Intronic
1138935979 16:61723715-61723737 TTGTGTGTCTGATAGGGTGGTGG - Intronic
1139575828 16:67841689-67841711 CTATGTGGCTGACACGGTGCCGG - Intronic
1148017371 17:44531575-44531597 TCTAGTTCCTGACAGGGTGCAGG + Intergenic
1149032563 17:52100645-52100667 TTAAGTGTCAGAAATGGTGTGGG - Intronic
1153477878 18:5517210-5517232 CTGAGAGTCTGACAGGGTGAGGG + Intronic
1155538407 18:26841384-26841406 TAAAGCGTCTAACAGAGTGCAGG + Intergenic
1157029328 18:43886103-43886125 TTGAGTTTCTGCCAGGTTGCGGG + Intergenic
1157505105 18:48220465-48220487 CTAAGTGTCAGGCATGGTGCTGG + Intronic
1163938738 19:20474047-20474069 TTTAGTGAGTGCCAGGGTGCAGG + Intergenic
1163979104 19:20881893-20881915 ATAAGTGTATGACAGTGTACAGG - Intergenic
1165201562 19:34149054-34149076 TGAAGTGTCTGCAAGAGTGCAGG + Intergenic
1165941478 19:39416740-39416762 GTCAGGGTCTGACAGGGGGCGGG - Intronic
924969259 2:109209-109231 TTAGGTCTCAGAAAGGGTGCAGG + Intergenic
932638974 2:73422676-73422698 TTGAGAGTCTGACAAGGTCCAGG - Intronic
933779140 2:85789263-85789285 CTTAGTGTCTGACAGGCAGCTGG - Intergenic
934476918 2:94599770-94599792 TGAAGGGGCTGACAGGGTGAAGG - Intronic
934526667 2:95056324-95056346 TTTAGTGGTTGACAGGATGCTGG + Intergenic
939255527 2:139740208-139740230 TTAAGTGTTTGAAAAGATGCTGG + Intergenic
940263006 2:151803714-151803736 TAAAGTGTCAGACAGCGTTCTGG - Intronic
942381375 2:175394830-175394852 TTAAGTGCCTGAGAAAGTGCTGG + Intergenic
942830389 2:180232543-180232565 TTAACTGGCTGACAGGGGCCTGG - Intergenic
943286438 2:186007562-186007584 ATAAGTGTCAGACACTGTGCAGG + Intergenic
944656691 2:201882697-201882719 GTATGTGTGTGACAGGGTGGTGG + Intronic
947048041 2:226010003-226010025 TGGAGTGTCTGAAAGGGTGGTGG + Intergenic
947776852 2:232719281-232719303 TTAAGTATCAGACACTGTGCTGG + Intronic
1168979584 20:1993369-1993391 TTTAATTGCTGACAGGGTGCTGG - Intronic
1169975738 20:11325300-11325322 TTTGGTGTCTGGCTGGGTGCTGG + Intergenic
1171302577 20:24076515-24076537 TTCAGTGTCTAACAGGACGCAGG - Intergenic
1173890026 20:46499948-46499970 TTAAGTAGCAGACAGGGGGCAGG + Exonic
1178039807 21:28627896-28627918 TTAAGTCTCTGACTGGTTGCTGG + Intergenic
1184655357 22:45938685-45938707 TGTAGTGTCTGACAGCATGCTGG + Intronic
952684016 3:36129514-36129536 TTAACTGGCTGACAGAGTCCTGG - Intergenic
953200168 3:40771290-40771312 TTCAGTGTCTGCCAGGCTGCTGG - Intergenic
954703964 3:52468681-52468703 TTAAGGGACCGGCAGGGTGCAGG - Intronic
955490066 3:59472959-59472981 TGAAGTGTATGATAGAGTGCTGG - Intergenic
955977476 3:64492231-64492253 TTCAGAGTCTGAGATGGTGCTGG + Intergenic
959752058 3:109849733-109849755 TTAAGTGGCAGGCAGGCTGCAGG + Intergenic
962927851 3:140011781-140011803 GTAAGTGTCTGGCAGGGGTCGGG + Intronic
965735734 3:171818651-171818673 TTAAGAGTATAACAGGGTCCAGG + Intergenic
967296269 3:187968125-187968147 TGAATCTTCTGACAGGGTGCTGG - Intergenic
967954568 3:194868518-194868540 CTATGTGTCCGGCAGGGTGCTGG + Intergenic
969474267 4:7412387-7412409 TTAGCTTTCTGACAGTGTGCAGG + Intronic
970741389 4:19241965-19241987 TTAAGAGTCTGGAAGGGGGCGGG + Intergenic
971756879 4:30718302-30718324 CTAAGTGTGTGTCAGGGAGCTGG - Intergenic
974439869 4:61902295-61902317 ACTAGTGTCTGACTGGGTGCGGG - Intronic
975012674 4:69376730-69376752 TTAAGTGGCTGACAGGTGCCCGG - Intronic
981672197 4:147299712-147299734 TTGAGTGTCTGGCAGGGAGCAGG - Intergenic
983978128 4:173961934-173961956 TGAGGTGTATGAAAGGGTGCTGG - Intergenic
984833720 4:183999824-183999846 TTAAGTGCCTGACAGTGAGGAGG + Intronic
986173284 5:5331166-5331188 ATGAGTGTGTGACAGGGTGCTGG - Intergenic
986450385 5:7857640-7857662 TTGACTGTGTGTCAGGGTGCCGG + Intronic
986807046 5:11317867-11317889 TCAGATGTCTGAAAGGGTGCAGG + Intronic
988339933 5:29958187-29958209 AAAAGTGTTTGACAGGCTGCTGG - Intergenic
988539686 5:32097828-32097850 TTTAGTGTCTGACATGGGCCTGG - Intronic
988962221 5:36381648-36381670 TTATGTTTCTTACAGGCTGCTGG + Intergenic
992011793 5:72534851-72534873 TTAAGCCTCTGAGAGGGAGCAGG + Intergenic
993575775 5:89598515-89598537 GAAAGTGTCTGATAGGGTACAGG - Intergenic
993655356 5:90571743-90571765 TTCAGTGGCTGCCAGGATGCTGG + Intronic
996434746 5:123422405-123422427 TTGAGTGTCAGACACTGTGCTGG - Intronic
996472004 5:123871824-123871846 TGAAGTGTCTGCCAAGGAGCAGG - Intergenic
996828119 5:127708741-127708763 TTAAGTGCCTGAGAGTGTACAGG + Intergenic
997695877 5:135860403-135860425 TTCAGTGTCTGAGAGGCAGCTGG + Intronic
998602541 5:143599657-143599679 TTAAGTGTATGAGCGGTTGCTGG - Intergenic
999106927 5:149080444-149080466 TTAAGTGGCTGACATAGAGCGGG + Intergenic
1000165021 5:158639995-158640017 TTCTGTGGCTGACAGGGTGGTGG + Intergenic
1000327441 5:160183097-160183119 TTATGTGTGTGACATGGGGCAGG - Intergenic
1001689957 5:173625594-173625616 GTAACTGTCTGACAGGCAGCAGG - Intergenic
1001772858 5:174308956-174308978 GTAGGTGTCTGCCAGGGTGATGG - Intergenic
1005482164 6:26265231-26265253 TTAAGTGTCTGACACCAGGCTGG - Intergenic
1008360046 6:50606410-50606432 TTAAGTGCCTGGCAGGTTCCTGG + Intergenic
1011839979 6:91485297-91485319 TTAAGAGTATGACAGGGAGGAGG - Intergenic
1014333261 6:120098002-120098024 ATAAGTGTTTGCCAGGGTGTAGG - Intergenic
1014989210 6:128053232-128053254 TTACGTGTGTGGCAGGGTGTGGG - Intronic
1015104662 6:129521617-129521639 TTAAGTGTCTGCCAGTGTTCTGG - Intergenic
1016424726 6:143922465-143922487 GTATGTGTGTGGCAGGGTGCTGG - Intronic
1016876831 6:148873680-148873702 TTAGCTGCCTGACATGGTGCAGG + Intronic
1017593617 6:156004791-156004813 TTGAGTGTGTGACAGGATGAGGG - Intergenic
1017603334 6:156106910-156106932 TTTAGTATATGACAGGGTCCTGG + Intergenic
1017970222 6:159305974-159305996 TTAAGTATCTCACAGGGGGCTGG + Intergenic
1022662585 7:32380671-32380693 TCAAGTGTGTCACAGGCTGCAGG - Intergenic
1023628954 7:42144081-42144103 TTAAGTGTCGGCCAGGGTACAGG + Intronic
1025060059 7:55798188-55798210 CTGAGTGTCTGGCAGGTTGCTGG - Intronic
1025873411 7:65456690-65456712 TAAAGTGTCTGGCATGTTGCAGG - Intergenic
1029314501 7:99699314-99699336 TTCTGTGTATGACAGGGTGGAGG + Intronic
1029320142 7:99751774-99751796 TTCTGTGTATGACAGGGTGGAGG + Intergenic
1031055344 7:116987269-116987291 TTAAGTATCTAACTGGGTTCTGG + Intronic
1034153527 7:148935844-148935866 TTTGGTGTCTGAGAGGGTCCTGG - Intergenic
1046847251 8:118931542-118931564 TTGTGTGTGTGTCAGGGTGCGGG - Intronic
1047968313 8:130063811-130063833 CCAAGTGCCTGAAAGGGTGCTGG - Intronic
1047971231 8:130086385-130086407 GTAAGTGCCTCACAGAGTGCTGG - Intronic
1051029504 9:12657820-12657842 TTAAATGACTGACAGAGGGCTGG + Intergenic
1051116991 9:13707082-13707104 GAAAGTGTCTGACAGGGAGTAGG - Intergenic
1051924169 9:22303636-22303658 GTATGTGTGTGACAGGGTGTGGG + Intergenic
1053681148 9:40486310-40486332 TGAAGGGGCTGACAGGGTGAAGG + Intergenic
1053931138 9:43114634-43114656 TGAAGGGGCTGACAGGGTGAAGG + Intergenic
1054282565 9:63138624-63138646 TGAAGGGGCTGACAGGGTGAAGG - Intergenic
1054294236 9:63321825-63321847 TGAAGGGGCTGACAGGGTGAAGG + Intergenic
1054392257 9:64626314-64626336 TGAAGGGGCTGACAGGGTGAAGG + Intergenic
1054426905 9:65131525-65131547 TGAAGGGGCTGACAGGGTGAAGG + Intergenic
1054503470 9:65890015-65890037 TGAAGGGGCTGACAGGGTGAAGG - Intronic
1057208841 9:93188684-93188706 TGTACTGTCAGACAGGGTGCGGG + Intronic
1057290245 9:93801802-93801824 TAAAGTGTCTGACAAAGTGCAGG - Intergenic
1057667839 9:97060490-97060512 ATCAGTGTCTGGCAGGGTCCAGG - Intergenic
1062468039 9:136690123-136690145 TCAAGGGTCAGACAGGGCGCTGG - Intergenic
1185574085 X:1156404-1156426 CTAAGGGTCAGACAGTGTGCAGG + Intergenic
1187611033 X:20943233-20943255 CTAATTCTCTGAAAGGGTGCTGG - Intergenic
1188684488 X:33053164-33053186 TTAAGTGTCAGGCATTGTGCTGG + Intronic
1193952079 X:87811847-87811869 TAAAGTGTTTGGCATGGTGCTGG + Intergenic
1195308867 X:103610571-103610593 TTAAGTGTCTGACAGGGTGCTGG - Intronic
1197850954 X:130859696-130859718 ATAAATGTCTGACAGGGTGGGGG + Intronic
1201982068 Y:19918680-19918702 TTAAGTGGCTGACAGGTGCCTGG + Intergenic