ID: 1195309295

View in Genome Browser
Species Human (GRCh38)
Location X:103615226-103615248
Sequence CTGAGGGAAGGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2077
Summary {0: 1, 1: 0, 2: 10, 3: 192, 4: 1874}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195309286_1195309295 3 Left 1195309286 X:103615200-103615222 CCAGAGCCATGGCTCAGAGATTT 0: 2
1: 3
2: 22
3: 61
4: 242
Right 1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG 0: 1
1: 0
2: 10
3: 192
4: 1874
1195309287_1195309295 -3 Left 1195309287 X:103615206-103615228 CCATGGCTCAGAGATTTTGCCTG 0: 1
1: 6
2: 13
3: 51
4: 276
Right 1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG 0: 1
1: 0
2: 10
3: 192
4: 1874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195309295 Original CRISPR CTGAGGGAAGGGAGGGAAGC AGG Intronic
Too many off-targets to display for this crispr