ID: 1195313808 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:103658577-103658599 |
Sequence | AGGGCTAAACAAATGGTGAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1195313803_1195313808 | 2 | Left | 1195313803 | X:103658552-103658574 | CCACAGTGAGGGTTAAGCAGAGA | No data | ||
Right | 1195313808 | X:103658577-103658599 | AGGGCTAAACAAATGGTGAATGG | No data | ||||
1195313802_1195313808 | 10 | Left | 1195313802 | X:103658544-103658566 | CCTAAAATCCACAGTGAGGGTTA | No data | ||
Right | 1195313808 | X:103658577-103658599 | AGGGCTAAACAAATGGTGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1195313808 | Original CRISPR | AGGGCTAAACAAATGGTGAA TGG | Intergenic | ||
No off target data available for this crispr |