ID: 1195313808

View in Genome Browser
Species Human (GRCh38)
Location X:103658577-103658599
Sequence AGGGCTAAACAAATGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195313803_1195313808 2 Left 1195313803 X:103658552-103658574 CCACAGTGAGGGTTAAGCAGAGA No data
Right 1195313808 X:103658577-103658599 AGGGCTAAACAAATGGTGAATGG No data
1195313802_1195313808 10 Left 1195313802 X:103658544-103658566 CCTAAAATCCACAGTGAGGGTTA No data
Right 1195313808 X:103658577-103658599 AGGGCTAAACAAATGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195313808 Original CRISPR AGGGCTAAACAAATGGTGAA TGG Intergenic
No off target data available for this crispr