ID: 1195316846

View in Genome Browser
Species Human (GRCh38)
Location X:103687504-103687526
Sequence CGCGCGCGCGTGCGTGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195316839_1195316846 11 Left 1195316839 X:103687470-103687492 CCCTGGCGTCGGGACTGGTGAGA No data
Right 1195316846 X:103687504-103687526 CGCGCGCGCGTGCGTGATGGTGG No data
1195316838_1195316846 12 Left 1195316838 X:103687469-103687491 CCCCTGGCGTCGGGACTGGTGAG No data
Right 1195316846 X:103687504-103687526 CGCGCGCGCGTGCGTGATGGTGG No data
1195316840_1195316846 10 Left 1195316840 X:103687471-103687493 CCTGGCGTCGGGACTGGTGAGAG No data
Right 1195316846 X:103687504-103687526 CGCGCGCGCGTGCGTGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195316846 Original CRISPR CGCGCGCGCGTGCGTGATGG TGG Intronic