ID: 1195318965

View in Genome Browser
Species Human (GRCh38)
Location X:103705818-103705840
Sequence GGTGTGGAAGAGCCCACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195318965_1195318968 3 Left 1195318965 X:103705818-103705840 CCTGAAGTGGGCTCTTCCACACC No data
Right 1195318968 X:103705844-103705866 TCTCTCTATTCTGACGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195318965 Original CRISPR GGTGTGGAAGAGCCCACTTC AGG (reversed) Intergenic
No off target data available for this crispr