ID: 1195319053

View in Genome Browser
Species Human (GRCh38)
Location X:103706641-103706663
Sequence GAACAGTCATAGGCTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195319053_1195319063 7 Left 1195319053 X:103706641-103706663 CCCAGTGCAGCCTATGACTGTTC No data
Right 1195319063 X:103706671-103706693 CTCGAGAGGTGGGGAACTTGCGG No data
1195319053_1195319059 -2 Left 1195319053 X:103706641-103706663 CCCAGTGCAGCCTATGACTGTTC No data
Right 1195319059 X:103706662-103706684 TCCAACCCTCTCGAGAGGTGGGG No data
1195319053_1195319057 -4 Left 1195319053 X:103706641-103706663 CCCAGTGCAGCCTATGACTGTTC No data
Right 1195319057 X:103706660-103706682 GTTCCAACCCTCTCGAGAGGTGG No data
1195319053_1195319058 -3 Left 1195319053 X:103706641-103706663 CCCAGTGCAGCCTATGACTGTTC No data
Right 1195319058 X:103706661-103706683 TTCCAACCCTCTCGAGAGGTGGG No data
1195319053_1195319056 -7 Left 1195319053 X:103706641-103706663 CCCAGTGCAGCCTATGACTGTTC No data
Right 1195319056 X:103706657-103706679 ACTGTTCCAACCCTCTCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195319053 Original CRISPR GAACAGTCATAGGCTGCACT GGG (reversed) Intergenic
No off target data available for this crispr