ID: 1195319750

View in Genome Browser
Species Human (GRCh38)
Location X:103711943-103711965
Sequence AAGAGCATAATGACCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195319750_1195319757 20 Left 1195319750 X:103711943-103711965 CCCCCAGAGGTCATTATGCTCTT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 1195319757 X:103711986-103712008 TCCAGATTAGACAGAAAACATGG 0: 1
1: 0
2: 2
3: 18
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195319750 Original CRISPR AAGAGCATAATGACCTCTGG GGG (reversed) Intronic
901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG + Intronic
905947120 1:41912578-41912600 CAGAGCATAATGTGCCCTGGAGG - Intronic
906265521 1:44425833-44425855 AAGAGCAAAATGGTCTTTGGGGG + Intronic
906283013 1:44566752-44566774 GAGAGAAAAAAGACCTCTGGAGG + Intronic
908696441 1:66847915-66847937 AAGACAAAAATTACCTCTGGAGG - Intronic
908946581 1:69505147-69505169 AAGAGGAAAATGAATTCTGGGGG + Intergenic
908993124 1:70118482-70118504 AAGAGCAGAATTATCTTTGGAGG + Intronic
909258279 1:73452724-73452746 AATATCAGAATGCCCTCTGGTGG - Intergenic
909569070 1:77087554-77087576 AAGCCCATAAGGACCTCTGGTGG - Intergenic
916183877 1:162112350-162112372 AAGAGCATCCTGGCCTCTAGTGG + Intronic
917836454 1:178945330-178945352 AAGAGCACAATGAGCACTGAGGG + Intergenic
920681598 1:208077304-208077326 TACAGCATAATTACCTCGGGGGG + Intronic
921468238 1:215517692-215517714 GGGAGCAGAATCACCTCTGGTGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065750706 10:28884388-28884410 AAGAGCAGAAAGATCCCTGGAGG - Intergenic
1066261212 10:33731275-33731297 AAGAGCATATATACCTATGGGGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1068076953 10:52268366-52268388 AAGAGGATAATGAGAACTGGTGG - Intronic
1072962777 10:99944169-99944191 AAGAGCATAATTAGCTGTAGAGG + Intronic
1073935959 10:108632228-108632250 AAGATTCTGATGACCTCTGGTGG + Intergenic
1074596132 10:114868673-114868695 AAGAGCAAAGTGACCCATGGTGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1080163980 11:29214529-29214551 AAGATAATAATGACCTTTGAGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085796866 11:79549778-79549800 AAAGGCATAATGACATCTGAGGG + Intergenic
1087376487 11:97348918-97348940 AAAAGCATAATGAACTCTGTGGG + Intergenic
1087542808 11:99542663-99542685 GAGGGCAAAATCACCTCTGGTGG + Intronic
1088132605 11:106512325-106512347 CAGAGCATAATGAACCCTGAGGG + Intergenic
1088581217 11:111318679-111318701 AAGATGATAATCACCACTGGGGG - Intergenic
1089195152 11:116689936-116689958 AAGTGAATAAGCACCTCTGGGGG + Intergenic
1089538613 11:119175650-119175672 CAGAGCCTAATCACCTCTGGAGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093071956 12:14715180-14715202 AAGAATATAATGACCACTAGTGG + Intergenic
1095612040 12:44140759-44140781 AAGAGAATACAGCCCTCTGGAGG - Intronic
1095946257 12:47755503-47755525 AAGATCAGAGTGACCTGTGGTGG - Intronic
1105657825 13:22459450-22459472 AAGAGCATAACCACCTGTGTGGG - Intergenic
1105915853 13:24915180-24915202 AAGATCCTATTGATCTCTGGAGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109023383 13:57129098-57129120 AACAGATTAATGCCCTCTGGTGG + Intergenic
1109987891 13:70014295-70014317 AAGCGAATAATGATCTCTGCAGG + Intronic
1112426686 13:99308676-99308698 AAGAACCTAATGACATCTGTGGG - Intronic
1113113415 13:106848774-106848796 AAGAGCATAAGAAACTCTGCAGG - Intergenic
1116440141 14:44941666-44941688 GAGAACATAATGACTTTTGGTGG - Intronic
1116919147 14:50554576-50554598 AAGACCATGATGCCCACTGGAGG + Intronic
1118591973 14:67408755-67408777 AAGAGCAGAAGGAGTTCTGGAGG - Intronic
1119488491 14:75009081-75009103 AAGAGGGTAATGAGCTCTGGGGG - Exonic
1119845124 14:77823475-77823497 AACAGTAGAATGAACTCTGGTGG + Intronic
1120905889 14:89621004-89621026 AAGAGCAAAAAGACATATGGGGG - Intergenic
1125932649 15:43611450-43611472 AAGAGGATAGAGACCTCTGGCGG + Intronic
1125945747 15:43710912-43710934 AAGAGGATAGAGACCTCTGGCGG + Intergenic
1128923217 15:71630968-71630990 GAGAGCATGATGGCATCTGGTGG - Intronic
1129170448 15:73804368-73804390 ATGAGCATAATAACTCCTGGTGG - Intergenic
1130204837 15:81866142-81866164 AAAAGAACACTGACCTCTGGAGG + Intergenic
1134273057 16:12751164-12751186 AAGATAATACTTACCTCTGGAGG + Intronic
1135855649 16:26007720-26007742 CAGAGCATAATGTCCCCTGAAGG - Intronic
1137901744 16:52276094-52276116 AAGATCAAAATCACCTCTTGAGG + Intergenic
1137963768 16:52911151-52911173 AAGGGCTACATGACCTCTGGAGG + Intergenic
1137963994 16:52913028-52913050 AAGGGCTATATGACCTCTGGAGG - Intergenic
1138497822 16:57419030-57419052 AAGAGCAGAGTGCCCTCTGGTGG - Intergenic
1138839367 16:60480526-60480548 AAGAGCACAATGATCTATTGTGG - Intergenic
1144585868 17:16487333-16487355 ATGAGCATAATGACCTCAGAAGG - Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1149673959 17:58442176-58442198 AAGAGGTAAATGACTTCTGGGGG - Intronic
1152147816 17:78579631-78579653 AAAACCAAGATGACCTCTGGTGG + Intergenic
1152511803 17:80795013-80795035 AATAGCAAAATGACTTCTGCAGG - Intronic
1153369058 18:4293824-4293846 AAAAGCTTAATTATCTCTGGTGG - Intronic
1157052576 18:44184600-44184622 AAGGGCAGAATTACCTCTTGGGG - Intergenic
1158437998 18:57447542-57447564 AAGAGCATTACCACCGCTGGGGG + Intronic
1160241126 18:77124004-77124026 AAGAGCAAAATGCCCTGTGCTGG - Intronic
1160681585 19:413859-413881 AAGAGTATCATGAACTCGGGGGG - Intergenic
1163071277 19:14844089-14844111 TAGAGCATAGGGACTTCTGGAGG - Intergenic
1163357683 19:16824908-16824930 CAAATCAAAATGACCTCTGGTGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
926448314 2:12971744-12971766 AAGAGCAAAATGATGTCTGTAGG - Intergenic
927507600 2:23624554-23624576 CAAAGCATCACGACCTCTGGTGG - Intronic
928001163 2:27524085-27524107 AGGAACATAAGGAACTCTGGAGG + Intergenic
929196509 2:39190592-39190614 AAGAGTATCATGGCCTCTGATGG - Intronic
929658997 2:43764252-43764274 AAGAGTCTAATGACCTTTGGAGG + Exonic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
938919256 2:135978743-135978765 AAGAGCTTAATGACCACATGTGG - Intronic
940167123 2:150786406-150786428 AAGAACATATTGACCTCTTTTGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941201777 2:162520525-162520547 AAAGGCATAATGATCTCTTGAGG + Intronic
945220997 2:207484203-207484225 AAGAGCATCAAGACCTCAGAGGG - Intergenic
947046813 2:225996397-225996419 AAGGGCATCATCATCTCTGGAGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1170129342 20:13001875-13001897 AAGAGGATCACGACCTCTGAGGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1178819048 21:35958683-35958705 AAGGGCATTGTGACCTCTGTGGG - Intronic
950049818 3:9979101-9979123 TATAGCATAATGAGCTCAGGAGG - Intronic
950874392 3:16256854-16256876 AAGAAATTAATGACATCTGGTGG + Intergenic
953411114 3:42690984-42691006 CAGAGCTCAATGACATCTGGAGG + Exonic
955293488 3:57714260-57714282 AAGTGCATATTAACCTGTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
958508216 3:95009673-95009695 AAGTGCATGATCACCTCTGCTGG - Intergenic
960239365 3:115322473-115322495 ATGAGGATAATGAGCTCTGCAGG + Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
963388143 3:144622924-144622946 ATGAGCATACTGGCCTCTTGAGG + Intergenic
963977641 3:151499651-151499673 AGGAGTAGAATGTCCTCTGGTGG - Intergenic
966132586 3:176659273-176659295 AAAAGCATAATGACCTCTCCAGG + Intergenic
967762009 3:193236750-193236772 AAGAGCATGATGATATTTGGGGG - Intergenic
968038237 3:195566967-195566989 AGGAGCCAAATGCCCTCTGGCGG + Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971731177 4:30383049-30383071 AACATTATAATGGCCTCTGGTGG + Intergenic
971868818 4:32208934-32208956 AAGGGCATAATGTCCTTTGTGGG - Intergenic
974157196 4:58089377-58089399 AAAAGCAGAAAGAACTCTGGTGG - Intergenic
974700652 4:65440981-65441003 GACAGCAAAATGACATCTGGTGG - Intronic
974828178 4:67155697-67155719 CAGAGCATAATGAACACTGGAGG + Intergenic
975154015 4:71051008-71051030 AAGTGTATAATGACCTCATGTGG - Intergenic
976754578 4:88484302-88484324 ATGAGCATAAAGACATCAGGAGG - Intronic
983662654 4:170145313-170145335 AACAGTGTAATGCCCTCTGGAGG + Intergenic
986050007 5:4081253-4081275 AGGAGCATGATGACCTCAGAAGG + Intergenic
986804837 5:11300056-11300078 AAGATCATAAGAGCCTCTGGGGG + Intronic
987917944 5:24240433-24240455 CAGAGCATAAAAACCTGTGGGGG + Intergenic
989689289 5:44121091-44121113 AAGAACATAAGGCCCTGTGGAGG + Intergenic
993049960 5:82915136-82915158 AAGGGGATAAAGACCTCAGGAGG - Intergenic
993319035 5:86449661-86449683 AAAAGCATAATGACCTTTCAAGG - Intergenic
993906098 5:93624639-93624661 GAGATGATAATGGCCTCTGGAGG + Intronic
993944047 5:94097107-94097129 AGGAGCATGATGAGCTTTGGGGG - Intronic
995248749 5:109965152-109965174 AAGAGCAGAGTGTCCTCTGATGG - Intergenic
995756696 5:115512883-115512905 AAGAGCTTTATGATCTATGGAGG - Intergenic
996254007 5:121375780-121375802 AAGAGCAAAATTTCGTCTGGGGG - Intergenic
1001068087 5:168556180-168556202 AAGAGCATGGTGGCCTCTTGGGG + Exonic
1001936668 5:175710380-175710402 AAGAGACTAAGCACCTCTGGGGG - Intergenic
1003478877 6:6512753-6512775 AAGAGCATAATGCCCTGGAGTGG + Intergenic
1005164681 6:22906314-22906336 GAGATTATCATGACCTCTGGAGG - Intergenic
1005771669 6:29079294-29079316 AAAGGCATAATGAGATCTGGGGG + Intergenic
1005898068 6:30195335-30195357 GAGAACAGAATGACATCTGGAGG + Intronic
1008666209 6:53719050-53719072 ATGAGCACAGTGACCTCTAGTGG - Intergenic
1010084798 6:71904530-71904552 AATAGCATCCTGACATCTGGAGG + Intronic
1016287301 6:142487519-142487541 CAGAGCAAAATGACCTCTAAGGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021704799 7:23356180-23356202 AAAAGGAAAATGACCTTTGGAGG - Intronic
1025722764 7:64031428-64031450 TACAGCATAATGCCCTATGGTGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1031115101 7:117658851-117658873 AAGAGCAGAATGAACTATTGGGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037328361 8:17718164-17718186 AAGAGCATTATGACTCATGGTGG - Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1040610743 8:48979138-48979160 AAGTGCATCCTGCCCTCTGGCGG - Intergenic
1044280161 8:90345482-90345504 AAGAGTATAATGACCACAGGTGG + Intergenic
1046083054 8:109396020-109396042 AAAATCATGGTGACCTCTGGGGG - Exonic
1046312990 8:112463451-112463473 AAGAGAAGAAAGACCTCTAGTGG - Intronic
1048436499 8:134423385-134423407 CAGAGCATAGTGACCTCTTCAGG + Intergenic
1049142634 8:140969961-140969983 AAGAGCACACTACCCTCTGGAGG + Intronic
1050389419 9:5123113-5123135 AAAAGCACACTGACCGCTGGTGG - Exonic
1051013968 9:12452689-12452711 AAGAGCAGAGTGACCTCAGGTGG - Intergenic
1052192923 9:25678695-25678717 AAGAGCAAAGTAACCACTGGTGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057086171 9:92212864-92212886 AAGAGAATAAGGAGCTTTGGGGG + Intronic
1057195174 9:93112501-93112523 CAGAGAATGATGACCTCTAGCGG + Intronic
1060084944 9:120689818-120689840 AAGAGCATAATGACTTTAGGTGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1187066669 X:15846610-15846632 AAGAGCATAGTTACCCTTGGGGG - Intronic
1187298716 X:18027489-18027511 AAGAGCATCCTGGCCTCTGCAGG + Intergenic
1187507912 X:19891648-19891670 AACTGCATAATCTCCTCTGGTGG - Intergenic
1189086678 X:38032573-38032595 AAGATCATGATTACCTCTGGTGG - Intronic
1194259933 X:91682055-91682077 AAGAGAATAATGACCAGAGGAGG + Intergenic
1194414557 X:93594587-93594609 AAGAGCATATTTACATTTGGAGG - Intergenic
1195319750 X:103711943-103711965 AAGAGCATAATGACCTCTGGGGG - Intronic
1196354724 X:114777270-114777292 AAGAGGAAAATGACCTTTGAAGG + Intronic
1196831053 X:119775850-119775872 AAGAGCAAACTGAGCCCTGGAGG - Intergenic
1197558513 X:127988714-127988736 AAGAGCATAATGAAATAGGGAGG - Intergenic
1197852816 X:130881900-130881922 AAGAGGAGAAAAACCTCTGGTGG + Intronic
1197882727 X:131185373-131185395 AACATCATAATCATCTCTGGTGG + Intergenic
1200578631 Y:4921246-4921268 AAGAGAATAATGACCAGAGGAGG + Intergenic
1200888137 Y:8292789-8292811 ATAAACATAATGAGCTCTGGTGG + Intergenic
1202056335 Y:20835335-20835357 AAGGTTATAATGAACTCTGGGGG + Intergenic