ID: 1195321657

View in Genome Browser
Species Human (GRCh38)
Location X:103726142-103726164
Sequence ACATGGATCTACTGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195321657_1195321663 16 Left 1195321657 X:103726142-103726164 CCTCTTTCCCAGTAGATCCATGT 0: 1
1: 0
2: 1
3: 25
4: 197
Right 1195321663 X:103726181-103726203 TAGAATAATAAAAATAGCTAAGG 0: 1
1: 0
2: 3
3: 80
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195321657 Original CRISPR ACATGGATCTACTGGGAAAG AGG (reversed) Intronic
903513869 1:23896847-23896869 AGATGGACCTACTGAGAAGGAGG - Intronic
904973568 1:34438026-34438048 ACAGGGATCTGCTAGGAAGGAGG - Intergenic
907897936 1:58710322-58710344 ACCTGGAGCTATTGGGAAAGAGG - Intergenic
909444000 1:75727762-75727784 ACTTAGATCTGCTGTGAAAGCGG + Intronic
910285720 1:85551996-85552018 GCATAGATTCACTGGGAAAGGGG + Intronic
910654446 1:89605567-89605589 TCAAGGACCTACTGGGAATGGGG + Intergenic
912948447 1:114104178-114104200 TCATGGACCTGCTGGGAGAGGGG - Intronic
913126318 1:115793618-115793640 CCAAGGATCTCCTAGGAAAGGGG - Intergenic
913538293 1:119795276-119795298 ACATGAATCAACTGAGAATGAGG + Intronic
916757954 1:167791145-167791167 ACAAGTGTGTACTGGGAAAGAGG - Exonic
917098072 1:171419543-171419565 ACAAGAATCTACTGGTAAAATGG + Intergenic
917099129 1:171428338-171428360 ACTTGGAAGTACTGGGAAGGAGG + Intergenic
917241313 1:172951480-172951502 ACATGAAGGTACTGGGAAGGTGG + Intergenic
917829895 1:178871096-178871118 ACTTGAGTCTACTGAGAAAGAGG - Intronic
919114078 1:193258998-193259020 ACATGGATTTAGAGGAAAAGCGG + Intergenic
919120844 1:193338508-193338530 AAATAAATCTCCTGGGAAAGGGG - Intergenic
920369327 1:205467999-205468021 ACATCTGTCTTCTGGGAAAGAGG + Intergenic
921285703 1:213607424-213607446 ACATGGTTTTACTGGAAGAGAGG + Intergenic
922367131 1:224876418-224876440 ATATTGATATACTAGGAAAGTGG + Intergenic
922864438 1:228847536-228847558 TCATGAATTTTCTGGGAAAGGGG + Intergenic
1063016829 10:2086781-2086803 CCATGCCTCCACTGGGAAAGAGG - Intergenic
1063196879 10:3752031-3752053 ACATGGTTTTAATGGGAAAGAGG + Intergenic
1063936778 10:11086539-11086561 ACATGGATTCACTGTGGAAGAGG - Intronic
1064616991 10:17168957-17168979 ACATGGATAGAATGGGGAAGAGG + Intronic
1065613995 10:27501451-27501473 AGATGGATCCACAGGGAAAAGGG + Intergenic
1067980977 10:51083827-51083849 ACAAGGATCTAAGGGGACAGAGG - Intronic
1068133797 10:52929830-52929852 ACAGAGATCTACTTGTAAAGTGG + Intergenic
1068480702 10:57585315-57585337 ACAGGGATCCACTGGGAGGGAGG + Intergenic
1069484291 10:68811409-68811431 TCATGAATTTTCTGGGAAAGAGG + Intergenic
1069812860 10:71175291-71175313 ACAAGGGTCTACTAGGGAAGGGG - Intergenic
1069866865 10:71509574-71509596 TGCTGGAACTACTGGGAAAGAGG - Intronic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1074520242 10:114214205-114214227 ACTTGGCTCTTCTTGGAAAGAGG - Intronic
1075227138 10:120639902-120639924 ATATGGCTCTACTGGGAGAATGG + Intergenic
1077961604 11:7081733-7081755 ACATGGATGTGCTGGGAGGGTGG - Intergenic
1078114698 11:8434703-8434725 ACCTGCATCTACCAGGAAAGAGG + Intronic
1078722753 11:13899088-13899110 CCATGACTCTGCTGGGAAAGCGG + Intergenic
1078837168 11:15042270-15042292 TCCTGGAGCTACTGGGAAAATGG - Intronic
1079236138 11:18692010-18692032 TCATGGGTTTTCTGGGAAAGTGG - Intergenic
1080953297 11:37062667-37062689 AGAGTGATCTACTGGGGAAGAGG + Intergenic
1083793608 11:65001848-65001870 TGTTGGAGCTACTGGGAAAGTGG - Intergenic
1085282254 11:75338991-75339013 ACATGCAATTACTGGTAAAGGGG + Intronic
1085863938 11:80266073-80266095 AAATGTATTTATTGGGAAAGTGG + Intergenic
1085957104 11:81411957-81411979 ACATAAATCTACTGAGAATGTGG + Intergenic
1086943813 11:92825339-92825361 ACATTAATCTACTGGGAGAGGGG + Intronic
1088447225 11:109945041-109945063 ACATGCATCTACAGGCAAAGAGG + Intergenic
1088560966 11:111115987-111116009 ACATGGCTCTCCAGGGAAAAGGG - Intergenic
1088904244 11:114142287-114142309 GCATAGAGCTACTGGGGAAGGGG - Intronic
1089472840 11:118734711-118734733 ACATGAGTTTTCTGGGAAAGGGG - Intergenic
1090272871 11:125400120-125400142 CCATTGATCAGCTGGGAAAGAGG + Intronic
1092198053 12:6561927-6561949 ACCTGGATCCCCTGGGCAAGTGG - Exonic
1093172252 12:15874238-15874260 ACAGGGATCCACTGGAAGAGTGG + Intronic
1093778574 12:23106821-23106843 ACATAGAGCTACTGGGAGAGAGG + Intergenic
1094148981 12:27261088-27261110 AAATGGAAGTACTGGGAAACCGG - Intronic
1095323630 12:40860715-40860737 ACATGGAGTTACTGGGAGAGTGG - Intronic
1098640679 12:72835298-72835320 TCATGAATTTTCTGGGAAAGGGG + Intergenic
1098921222 12:76303956-76303978 TCATGAATTTTCTGGGAAAGGGG + Intergenic
1099321505 12:81156335-81156357 AAATGGATATACTAGAAAAGAGG + Intronic
1101353823 12:103957649-103957671 ACCTGGTGCTACTGGGAAAGGGG + Intronic
1104061234 12:125270355-125270377 ACATGCAACTTCTTGGAAAGTGG - Intronic
1104808546 12:131605336-131605358 TCATGAGTCTTCTGGGAAAGGGG - Intergenic
1105576473 13:21657735-21657757 GCATGCATCTGCTGGGCAAGGGG + Intergenic
1107049163 13:36028947-36028969 TCATGAATTTTCTGGGAAAGGGG - Intronic
1109624655 13:64958928-64958950 CCATGGATCTACTGGAATACTGG - Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1113004089 13:105679135-105679157 ACATGGATGTGCTGGGAGGGTGG + Intergenic
1113141042 13:107149795-107149817 ATATGCATCAACTGGGGAAGAGG - Intergenic
1113407340 13:110053893-110053915 ACCTGGATGTAGTGGGAATGTGG - Intergenic
1113862608 13:113499040-113499062 TCATGAATTTTCTGGGAAAGGGG + Intronic
1115356848 14:32457261-32457283 ATATTGATCAAGTGGGAAAGGGG + Intronic
1118427764 14:65685677-65685699 TCATGAATTTTCTGGGAAAGGGG + Intronic
1119220984 14:72907233-72907255 ACATGGTGCTGCTGGAAAAGGGG + Intergenic
1119846555 14:77834783-77834805 ACCTGGTTCTACAGGGTAAGTGG + Intronic
1120116779 14:80627090-80627112 ACATGGAGATTCTGGGAAACTGG + Intronic
1120895305 14:89525474-89525496 ACATGGGTTTTCTGGGAAAGGGG - Intronic
1121283206 14:92714393-92714415 CCATGGATCTACTGGAATACTGG - Exonic
1121459775 14:94065889-94065911 ACAGGGATCCACTGGGAGGGTGG + Intronic
1121673830 14:95735758-95735780 GCATGGATATGCTGGGAAAAGGG - Intergenic
1121962583 14:98275059-98275081 GCATGGGTCTGCAGGGAAAGGGG - Intergenic
1125170148 15:36757625-36757647 GCATGGATGTGCTGGGCAAGGGG - Intronic
1125905013 15:43383701-43383723 AAATGCATATATTGGGAAAGAGG - Intronic
1128465708 15:67909333-67909355 TCATGAGTTTACTGGGAAAGGGG - Intergenic
1129231350 15:74198896-74198918 ACATGATTCTGCTGGGGAAGCGG - Intronic
1130396194 15:83504263-83504285 ACAGGGAACTTCTGGGAAACTGG - Intronic
1131549368 15:93343690-93343712 TCATGAATTTTCTGGGAAAGGGG + Intergenic
1132803605 16:1765837-1765859 AGCTGGGTCTGCTGGGAAAGTGG + Intronic
1134778913 16:16877708-16877730 AGATAGAACCACTGGGAAAGAGG + Intergenic
1134864364 16:17591500-17591522 TCATGTGTCTTCTGGGAAAGGGG - Intergenic
1136515320 16:30764736-30764758 ACCTGGACATGCTGGGAAAGTGG + Intronic
1138673325 16:58632670-58632692 ACATGGAATTACTGGGTCAGTGG - Intergenic
1138830379 16:60367615-60367637 ACATGGAGGTCCTGGCAAAGTGG + Intergenic
1139152356 16:64397895-64397917 ACTTGGATCTGCCTGGAAAGTGG + Intergenic
1139682113 16:68573144-68573166 ACCTGGAGCTCCTGGGAAGGAGG + Intronic
1140410448 16:74737805-74737827 ACATGGAGGAGCTGGGAAAGAGG - Intronic
1140640203 16:76963021-76963043 ACATGGAACCACAGGGAACGAGG - Intergenic
1140642538 16:76993285-76993307 AAATGCATCTTCTGGAAAAGGGG - Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1147063032 17:37897476-37897498 TCATGAATTTTCTGGGAAAGGGG - Intergenic
1147367829 17:39970883-39970905 ACAGGGAACTACTGGGGAAGGGG + Intronic
1148774873 17:50089652-50089674 AGATGGATCCAGTGTGAAAGGGG - Exonic
1149991979 17:61388397-61388419 AGATGGATCTGCTGTGACAGAGG - Intronic
1153713384 18:7821808-7821830 GCATGGATCTACTGGTCAAAGGG + Intronic
1154094007 18:11393482-11393504 ACAAGGATCCATTGGGAAGGTGG + Intergenic
1156925565 18:42573787-42573809 TCATGGATCTACAAGGATAGAGG + Intergenic
1157331207 18:46705100-46705122 ACGAGGATCAAGTGGGAAAGGGG - Intronic
1159306396 18:66648570-66648592 AAATGGATCTCTTGGGCAAGGGG - Intergenic
1160021142 18:75182880-75182902 ACCTGGATACCCTGGGAAAGGGG - Intergenic
1164780490 19:30887485-30887507 ACATTCATCTACTGGGAAACGGG + Intergenic
925874716 2:8302013-8302035 ACAGGGCTCTAATGGGAAAGAGG - Intergenic
930545648 2:52763981-52764003 AAATGGAGATACTGGGAAAGTGG - Intergenic
931113445 2:59138558-59138580 AGATGGTTATAGTGGGAAAGAGG - Intergenic
932168401 2:69530193-69530215 AAATGGATCTAATGAGAAACTGG + Intronic
932486767 2:72088864-72088886 TCATGGATTTTCTGGGAAAGGGG - Intergenic
933808723 2:86018604-86018626 AAATGGATCTAGTGGTGAAGGGG - Intergenic
939517344 2:143185608-143185630 ACAAGGATCTATCGGGAATGAGG - Intronic
939805218 2:146767384-146767406 ACATGGATATACTGGACAAAGGG - Intergenic
942248007 2:174025173-174025195 ACAGGGATCTCCAGGGAAGGTGG + Intergenic
943861620 2:192872186-192872208 ACATATATCTACTTGGGAAGGGG - Intergenic
946526627 2:220527660-220527682 ACATGGACCCCCTGGTAAAGTGG + Intergenic
947207133 2:227672246-227672268 ACAGGGATCTTCTGGGGGAGTGG - Intergenic
1169514468 20:6300658-6300680 ACATGGGTCACCTGGGAAGGGGG - Intergenic
1170802396 20:19601279-19601301 ACCTGGAGCTTCTGGGCAAGAGG - Intronic
1172176782 20:32977325-32977347 CCCTGGATCCACAGGGAAAGAGG - Intergenic
1177432440 21:21007521-21007543 TCATGAATTTTCTGGGAAAGGGG + Intronic
1178239964 21:30887681-30887703 ACATGCACCTACTGTGAAATGGG + Intergenic
1178967136 21:37131425-37131447 ACATTGATGTGCTGAGAAAGTGG + Intronic
1179515410 21:41903106-41903128 GCATGCACGTACTGGGAAAGGGG + Intronic
1180664473 22:17498914-17498936 ACACGGATATAATGGGAAGGTGG - Intronic
1183856899 22:40640808-40640830 TCATGAATTTTCTGGGAAAGGGG - Intergenic
1184544307 22:45156054-45156076 ACAGACTTCTACTGGGAAAGAGG - Intergenic
950002186 3:9665570-9665592 ACATGGATATATTGTGTAAGCGG - Intronic
950817416 3:15720625-15720647 GGAGGGATCAACTGGGAAAGGGG - Intronic
952559088 3:34568655-34568677 TCATGGATTTTCTGGGAAAGGGG + Intergenic
952799879 3:37279949-37279971 AAATGGATCCACTAGGAAGGAGG - Intronic
954974047 3:54676215-54676237 ATAAGGAACTGCTGGGAAAGGGG - Intronic
957624107 3:82636908-82636930 ACATGGATATGATTGGAAAGAGG - Intergenic
958573363 3:95915012-95915034 ACATTGTTTTACTGGCAAAGTGG - Intergenic
959598926 3:108157241-108157263 ACATGGAAGTGCTGGGACAGTGG + Intergenic
960016077 3:112889556-112889578 ACAGGGATCCACTGGGAGGGCGG - Intergenic
963163369 3:142175369-142175391 AAAGGAATCTACTGAGAAAGGGG - Intronic
963968555 3:151402448-151402470 ACTTGGATTTACTGGGGATGGGG + Intronic
965276484 3:166689786-166689808 ACATGAATATACTGGTATAGTGG + Intergenic
967090581 3:186131441-186131463 AGATGGACTTCCTGGGAAAGTGG + Intronic
967453100 3:189649733-189649755 ACATGGATCTGAGGGGAATGAGG + Intronic
968284891 3:197502721-197502743 ACATGAATCTCCTGGGAAACTGG - Intergenic
969163528 4:5282751-5282773 GCATAGATATACTGGGCAAGGGG + Intronic
969303717 4:6312775-6312797 AGATGGATTAACTGGGAAACAGG + Intergenic
970140927 4:12981332-12981354 GCTTGGATATACTGGTAAAGTGG + Intergenic
970316786 4:14835662-14835684 TCATGGATTTACTGTGACAGGGG - Intergenic
973238432 4:47931245-47931267 AAATGAATCTAATTGGAAAGAGG + Intronic
973801499 4:54483059-54483081 AGGTGGATCTTCTGAGAAAGGGG - Intergenic
973910793 4:55578220-55578242 ACATGGATGTACAGGGACAGAGG - Intronic
974543907 4:63275485-63275507 ACATGCATGTACTGTCAAAGTGG - Intergenic
975299199 4:72769639-72769661 ATATGGATTTACTGAGAAAATGG + Intergenic
975984745 4:80192137-80192159 GCATGGCTCTTCTGGGAAAGAGG - Intronic
976449801 4:85175263-85175285 ATATGGATCTATTGGGTAAATGG - Intergenic
976804223 4:89027815-89027837 ACATGGATACACTGGACAAGGGG + Intronic
978428878 4:108611454-108611476 ACAGAGAACTACTGGGAAATAGG + Intergenic
978873341 4:113607289-113607311 ACATGGATGAACTGGGACTGTGG + Intronic
979725337 4:123954356-123954378 TCATGGGTGTTCTGGGAAAGGGG + Intergenic
980956084 4:139430653-139430675 ACATGTATCTGCTGGGTGAGTGG + Intergenic
981008146 4:139896843-139896865 GGATGGTTCTACAGGGAAAGGGG + Intronic
983489635 4:168373300-168373322 ACATGGATCTTTGGGGACAGTGG - Intronic
984018647 4:174457029-174457051 ACATTAATCTACTGGTAAATTGG + Intergenic
984792654 4:183628606-183628628 AAATGGATCCACTGTGAAATGGG + Intergenic
985988536 5:3537049-3537071 GCATGAACCTACTGGGTAAGGGG - Intergenic
987157575 5:15106009-15106031 ACATTGTTCTACTGGGAAGGCGG + Intergenic
988180005 5:27778312-27778334 GCATGGATCTGTTGGCAAAGGGG - Intergenic
999751473 5:154631208-154631230 AAGTGGATCTGCTGGGACAGGGG - Intergenic
999875839 5:155804713-155804735 GCATGGATCAACCGTGAAAGAGG + Intergenic
1001468177 5:171987376-171987398 ACATGGATGTATTGGGATAGTGG - Intronic
1003123998 6:3340711-3340733 AGATGGGGCTACTGGGAAAAGGG + Intronic
1003761168 6:9180483-9180505 ATATGGATATACTGGGAAGGGGG + Intergenic
1004763325 6:18695827-18695849 AGATGGATCTAACTGGAAAGTGG + Intergenic
1004850096 6:19690542-19690564 TCATGAGTCTTCTGGGAAAGGGG - Intergenic
1007194372 6:40047880-40047902 ACATGGATGTGCTTGGAAGGTGG - Intergenic
1009384206 6:63069079-63069101 ACAGGGATCCATTGGGAGAGTGG - Intergenic
1011233253 6:85187516-85187538 ACATGGATCTACTGGGAGGGTGG + Intergenic
1011721173 6:90158039-90158061 ATATGGAGCTGCTGGGGAAGGGG + Intronic
1014084195 6:117323850-117323872 AAATGGATCTTCTGCAAAAGAGG + Intronic
1015235975 6:130971568-130971590 ACATGGAGCCACTGGGCAAATGG + Intronic
1022349500 7:29554370-29554392 ACATGAATCTATGGGGAAAGTGG - Intergenic
1022561672 7:31355829-31355851 TGATGGCACTACTGGGAAAGGGG + Intergenic
1022642793 7:32204157-32204179 ACATGGATCCACTGGACAAAGGG + Intronic
1024231054 7:47363890-47363912 ACATGGATCTAAGCTGAAAGAGG + Intronic
1029796052 7:102895639-102895661 ACATGAATCTGTAGGGAAAGTGG + Intronic
1030075768 7:105735145-105735167 AAGGGGATCTAGTGGGAAAGTGG - Intronic
1030089099 7:105841540-105841562 ATATGGATCTGCTGGGCAAAGGG - Intronic
1030440224 7:109579914-109579936 CCATGGCTCTACTGGAAATGTGG - Intergenic
1032543645 7:132724592-132724614 ACAGGGAGCTTCTGGGAATGAGG - Intronic
1033088244 7:138361974-138361996 ACATGGATCCACTGGACAAATGG - Intergenic
1035696853 8:1604378-1604400 ACATGGATCTATTTGGATGGAGG - Intronic
1036747126 8:11417806-11417828 TCATGGATTTTCTGGGAAAGGGG + Intronic
1037311799 8:17563890-17563912 ACATGGTTCTACAGGGTTAGTGG - Intronic
1037691591 8:21185647-21185669 ACATGGAAGCACAGGGAAAGAGG - Intergenic
1038803685 8:30771690-30771712 TCATGGAGCTACTGGCAATGAGG - Intergenic
1041615130 8:59897992-59898014 ACATGGATACACTGGAAAAAGGG + Intergenic
1042651423 8:71046082-71046104 TCATGTAGCTACTGGCAAAGTGG + Intergenic
1044325227 8:90851124-90851146 ACATGCAGGTTCTGGGAAAGTGG + Intronic
1048600266 8:135912347-135912369 TCATAGAATTACTGGGAAAGAGG + Intergenic
1049326988 8:142026894-142026916 ACATAGAGCTACTGGGCAATAGG + Intergenic
1051608461 9:18939195-18939217 ACATTGAGCTAGTGGGATAGAGG - Intronic
1052085862 9:24264685-24264707 CCTTGGATTTACTGGGAAAATGG + Intergenic
1052387745 9:27842018-27842040 ACATTGATTTAGTGGTAAAGAGG + Intergenic
1054892785 9:70270325-70270347 ACATCCATATGCTGGGAAAGTGG - Intronic
1055441040 9:76336739-76336761 ACATGTAATTACTGAGAAAGGGG - Intronic
1055518036 9:77052869-77052891 TCATGAGTTTACTGGGAAAGGGG + Intergenic
1055905893 9:81292873-81292895 ACAGGGATCCACTGGGAGCGTGG - Intergenic
1056984216 9:91346382-91346404 ACATGGATGTGCTGGGTAAGTGG + Intronic
1060190475 9:121589172-121589194 ACATGGATCCACATGGAGAGGGG + Intronic
1060360196 9:122948795-122948817 ACATGCATGTACTGGGGATGTGG - Intronic
1060431248 9:123552839-123552861 ACATGGATTTACTGGGTAAACGG - Intronic
1061302837 9:129715625-129715647 ACTAGGATCTAATGGTAAAGAGG - Intronic
1062158202 9:135065781-135065803 ACAGGGAGCTACAGGGAAGGGGG - Intergenic
1185636970 X:1559883-1559905 AAAGGGATGTACTGGAAAAGAGG + Intergenic
1186124946 X:6403024-6403046 ACATTGAGCAACTGGGAAAAGGG - Intergenic
1186616452 X:11193439-11193461 ACATGGATATCCTGGGAACCAGG - Intronic
1188352005 X:29143558-29143580 ACATGGATCTGCTGGACAAAGGG - Intronic
1192450130 X:71239491-71239513 CTTTGGATCTACTGGGAATGTGG - Intergenic
1192991379 X:76461558-76461580 TCAGGGAGCTACTGGGAATGTGG - Intergenic
1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG + Intronic
1195321657 X:103726142-103726164 ACATGGATCTACTGGGAAAGAGG - Intronic
1201328696 Y:12795698-12795720 TCATGGGTTTTCTGGGAAAGGGG + Intronic
1201731098 Y:17204147-17204169 ACATAGCCCTACTGGGAAAAGGG - Intergenic