ID: 1195322020

View in Genome Browser
Species Human (GRCh38)
Location X:103728153-103728175
Sequence CAGGGTCCAGAGAAGAAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 8, 3: 61, 4: 592}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195322008_1195322020 12 Left 1195322008 X:103728118-103728140 CCCCACTCAGCTCACCTGAGGAG 0: 1
1: 0
2: 0
3: 22
4: 242
Right 1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 61
4: 592
1195322007_1195322020 13 Left 1195322007 X:103728117-103728139 CCCCCACTCAGCTCACCTGAGGA 0: 1
1: 0
2: 1
3: 30
4: 283
Right 1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 61
4: 592
1195322009_1195322020 11 Left 1195322009 X:103728119-103728141 CCCACTCAGCTCACCTGAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 61
4: 592
1195322004_1195322020 24 Left 1195322004 X:103728106-103728128 CCTCCTTCTCACCCCCACTCAGC 0: 1
1: 0
2: 5
3: 74
4: 697
Right 1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 61
4: 592
1195322011_1195322020 10 Left 1195322011 X:103728120-103728142 CCACTCAGCTCACCTGAGGAGGA 0: 1
1: 0
2: 0
3: 26
4: 185
Right 1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 61
4: 592
1195322013_1195322020 -2 Left 1195322013 X:103728132-103728154 CCTGAGGAGGACCTGCCCTGGCA 0: 1
1: 0
2: 4
3: 26
4: 267
Right 1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 61
4: 592
1195322005_1195322020 21 Left 1195322005 X:103728109-103728131 CCTTCTCACCCCCACTCAGCTCA 0: 1
1: 0
2: 6
3: 53
4: 560
Right 1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG 0: 1
1: 0
2: 8
3: 61
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195322020 Original CRISPR CAGGGTCCAGAGAAGAAGGA AGG Exonic
900471326 1:2856417-2856439 CAGAGTCCAGGAAGGAAGGAAGG - Intergenic
900542037 1:3207854-3207876 CAGGAACCAGAGGAGAAGGCAGG + Intronic
900851551 1:5146946-5146968 CATGGTCCAGTGAAGAAGTTTGG + Intergenic
901295971 1:8161169-8161191 CTGGGTCTGGTGAAGAAGGAAGG - Intergenic
901650397 1:10739720-10739742 GAGGGCCCAGAGAAACAGGAGGG - Intronic
901902823 1:12380591-12380613 CAGGGGTCTGAGAAGTAGGAAGG + Intronic
901928853 1:12584027-12584049 CAGGGACCAGAACAGAAGAATGG - Intronic
902104002 1:14018359-14018381 CAGGGTACGGGGGAGAAGGAGGG + Intergenic
902913017 1:19615053-19615075 GTGGGTCCAGAGAAGGAGGATGG - Intronic
903692379 1:25183689-25183711 AAGGGTGGAGAGATGAAGGACGG - Intergenic
903813475 1:26047312-26047334 CAGAGTCCAGAGAAGCAGAGAGG - Intergenic
903991623 1:27274886-27274908 CATGGTAGAGAGAAGAAGAAAGG + Intronic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904919806 1:33998248-33998270 CAGAGTCCAGAGGAGATGCAGGG - Intronic
905458361 1:38104116-38104138 CAGGGTCCTAAGGAGAAAGAAGG + Intergenic
905875714 1:41431057-41431079 GAAGGTCCAGAGACCAAGGAAGG + Intergenic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906949654 1:50323805-50323827 GAGGGACCAGAGAGGAAGAACGG - Intergenic
907056432 1:51373099-51373121 CAGGATGTAGAGAAGAAAGAAGG + Intronic
907363998 1:53945366-53945388 CAGGGTCTAGAGGAAAAGGCGGG + Intronic
907407551 1:54262910-54262932 CAGGGTCCAGGGCAGCTGGAAGG - Intronic
907569387 1:55468805-55468827 GGGGGTAGAGAGAAGAAGGAAGG + Intergenic
907689271 1:56645672-56645694 CAGGGTCCAGGGAAGAGGGCGGG + Intronic
908267466 1:62393551-62393573 CAGGATCCAGAGCAGAAGGAAGG - Intergenic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910160880 1:84271036-84271058 CAGGGACAAGGGAAGAAGCAGGG + Intergenic
911254336 1:95616944-95616966 AAGGGTCCAGAGCAGAGGAATGG - Intergenic
912190004 1:107327044-107327066 CTGAGTCCAGAGAAGGAGGGAGG - Intronic
912368726 1:109156489-109156511 CAGGGGCTAGAGGAGCAGGATGG - Intronic
912747620 1:112258497-112258519 CATGGTGCAGAGAGGAAGCAAGG - Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913338505 1:117733314-117733336 CAGGGACGAGAGGAGCAGGAGGG - Intergenic
913419479 1:118649283-118649305 CATTGTCTAGAGAAGAATGAGGG - Intergenic
913483649 1:119314216-119314238 CAGGGTACCGAAAAGAAGAAGGG + Intergenic
914353254 1:146858436-146858458 CAGGGTAGGGAGAATAAGGAAGG + Intergenic
915125716 1:153662469-153662491 AAGCCACCAGAGAAGAAGGAAGG - Exonic
915520574 1:156440062-156440084 CAGGCTCCCGAGAAGAATGCAGG - Intergenic
916361702 1:163977196-163977218 GAGCATCCAGTGAAGAAGGAGGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917800231 1:178563209-178563231 CAGAGTTCAGAGCAGAAGAAAGG + Intergenic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
917930880 1:179821717-179821739 GAGGATTCAGAGCAGAAGGAAGG - Intergenic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
919015222 1:192024894-192024916 GAGGGTGGAGAGAGGAAGGAGGG - Intergenic
920063130 1:203242216-203242238 GAGGTTGCAGAGAAAAAGGAGGG - Intronic
920089184 1:203440342-203440364 CAGGGCCCAGAGAGGATGGGTGG - Intergenic
920128038 1:203709298-203709320 CAGCCTCCAGAGAAGGAGGGAGG + Exonic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920742779 1:208597288-208597310 CAGCCTCCAGAGAAGAAGGCTGG + Intergenic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921300890 1:213750514-213750536 CAGGGTGCTGAGAATAAGGATGG + Intergenic
922150054 1:222993267-222993289 CAGCTGCCAGAGAAGAAGGAAGG + Intronic
923010134 1:230082147-230082169 CACGGACTAGAGAAGAAGGATGG - Intronic
923080197 1:230646043-230646065 CAGGGTCCTGAGAAGGGAGAGGG - Intronic
923322190 1:232845585-232845607 CAGAGTCAAGGGAAGAAAGATGG - Intergenic
1062974184 10:1671585-1671607 CAGAATCCAGAGAAGCACGAGGG - Intronic
1062984285 10:1753163-1753185 CATGGTCCACAGAAGTAGGCAGG + Intergenic
1063167255 10:3474482-3474504 CAGGGCTCAGTGAAGAAAGAGGG - Intergenic
1063367526 10:5500111-5500133 CAGGGTCTAGAGACAGAGGATGG + Intergenic
1064708000 10:18092905-18092927 GAGGGTCTAGAGTAGAAGGAAGG + Intergenic
1065995949 10:31059733-31059755 CATGTTCCAGAGAAGAAATATGG + Intergenic
1067024841 10:42836080-42836102 CAGGGGCCAGAGCAGCAGCAAGG - Intergenic
1067787358 10:49260255-49260277 GAGGGTGCCGAGAAGAAAGAGGG + Intergenic
1069403928 10:68077837-68077859 CAGGGACCTGAGAAGATGGAGGG + Intergenic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1069874893 10:71555795-71555817 CAAGCTCCTGAGAAGAAGGGAGG + Intronic
1070539559 10:77406419-77406441 CAGGGGCACGAGAAGAAGCAAGG - Intronic
1071144332 10:82549957-82549979 CAGGGGCCAGAGAAGGGGGTTGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1072094533 10:92164203-92164225 CAAGGTCCAGAGAAGATGACTGG + Intronic
1072439280 10:95439409-95439431 CAAGGGCCAGAGAAGGAGGAAGG - Intronic
1072530908 10:96318072-96318094 CAAGGTCCAGAAAAGATGGAAGG - Intronic
1072832477 10:98673606-98673628 CCTGGTCCAAAGAAGAAGGATGG - Intronic
1073318546 10:102599903-102599925 CAGGCTCCAGGAAGGAAGGAAGG - Intronic
1074846127 10:117399630-117399652 AAGGGTGCACAGAAGAAAGATGG - Intergenic
1075563034 10:123482150-123482172 CAGGGGCCAGATAAGAAGGAAGG - Intergenic
1075762403 10:124866630-124866652 CAGGGTCATAGGAAGAAGGAAGG - Intergenic
1075855236 10:125624359-125624381 CAGAGACCAGAGAAGAAAGTGGG + Intronic
1076266403 10:129112699-129112721 CGGTGTCAAGAGAAGAAGGTGGG + Intergenic
1076617284 10:131763892-131763914 CAGGGTGCAAAGAAGAGGAAAGG + Intergenic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1077295804 11:1825725-1825747 CTGGGCTCAGAGAATAAGGAAGG - Intergenic
1078430063 11:11281626-11281648 CAAGGTCTAGAGAGGAAGGCAGG + Intronic
1078839857 11:15068536-15068558 AAGGGTACAGAGAAGCAGGCTGG + Intronic
1078889282 11:15539632-15539654 CAGGGTCCAGTGAGACAGGAGGG - Intergenic
1079509348 11:21192894-21192916 CAGTGTCGAGAGAAAGAGGAAGG + Intronic
1079973292 11:27062252-27062274 TAGGCAACAGAGAAGAAGGAAGG + Intronic
1080787559 11:35489554-35489576 CATGGTTCTGAGATGAAGGATGG - Intronic
1080897291 11:36457190-36457212 CTGGGACCAGAGAAGACAGAGGG - Intronic
1081338193 11:41894308-41894330 AAGGCACCAAAGAAGAAGGAGGG - Intergenic
1081780759 11:45710250-45710272 AAGGGTGCAGAGAAGAAGAGGGG + Intergenic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1082638726 11:55628705-55628727 GAGGGACCAGAGAACAAGGCTGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082728817 11:56770101-56770123 CAGGGGCCAAAGAACAAGGAAGG + Intergenic
1083429971 11:62609216-62609238 CAGGGCCTAGAGCAGAATGATGG + Intronic
1083811935 11:65111183-65111205 CCGGGGCCAGATAAGAAGGGAGG - Intronic
1084334699 11:68449893-68449915 CAGGGCCCAGTGAAAAATGAAGG - Intergenic
1084391710 11:68881572-68881594 CTGGGTCCAGTGGAGTAGGAAGG - Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1087726362 11:101721478-101721500 CAGCGCCCAGTGAAGAACGAGGG - Intronic
1088316307 11:108510226-108510248 CAGGCTCCAGTGGAAAAGGAGGG + Exonic
1088375950 11:109141648-109141670 AAGGGACCAGAGAAGAGGAATGG - Intergenic
1088421506 11:109653272-109653294 AATGGTCCACAAAAGAAGGATGG + Intergenic
1088528938 11:110787014-110787036 AAGGATCCAGAGGAGATGGAAGG + Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1090516274 11:127431054-127431076 GAGGCTGCAGAGAAAAAGGAAGG - Intergenic
1090626844 11:128615560-128615582 TAGGGACCAGAGAAGCAGGAGGG + Intergenic
1090920756 11:131204093-131204115 CAAGCTCCAGAGAAAGAGGAGGG + Intergenic
1090934077 11:131326381-131326403 CATTTTCCAGATAAGAAGGAAGG - Intergenic
1091196185 11:133732742-133732764 CAGGGCTCAGAGCAGCAGGAGGG - Intergenic
1091628595 12:2141253-2141275 AAGGCTCCAGAGGAGCAGGAAGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092019998 12:5193729-5193751 CTGGGGCGAGAGAAGCAGGAGGG + Intergenic
1092078555 12:5693678-5693700 CAGTGGCTGGAGAAGAAGGAAGG - Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092291255 12:7160553-7160575 AAGAGGCCAGAGAAGGAGGAAGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1092621737 12:10279136-10279158 GAGGGTGGAGAGTAGAAGGAGGG - Intergenic
1092956280 12:13553231-13553253 CAGGGACCAGAGGATAAGGGAGG + Exonic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1095709090 12:45269101-45269123 CTGGCCCCAGAGAAGAAGGGAGG - Intronic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096324518 12:50647471-50647493 CAGGGTGGAGAGGAAAAGGAGGG - Intronic
1096557999 12:52415583-52415605 GAGGATCCAGAGAAGAAAGGCGG - Intergenic
1096670258 12:53194247-53194269 GAGGGTCCTGAGAAGAGGGAGGG - Exonic
1096774932 12:53957837-53957859 CATGGACCAGAGCAGAGGGAGGG + Exonic
1096967666 12:55641321-55641343 CAGGGGCCAGAGAGGACGGCAGG + Intergenic
1098225363 12:68316347-68316369 CAGGGACCAAAGACAAAGGAAGG + Intronic
1098291248 12:68958647-68958669 CAGGTGCCAGAGAGGAAGCAGGG - Intronic
1098305180 12:69095593-69095615 CAGGGGTCAGAGATGAATGAAGG + Intergenic
1100052063 12:90460924-90460946 CAGGAGCAAGAGAGGAAGGAGGG + Intergenic
1100125961 12:91425338-91425360 CAGGGCCCAGTTAAGAATGAAGG - Intergenic
1101683831 12:106996600-106996622 GAGGATGCAGAGAAAAAGGAAGG - Intronic
1101820005 12:108176320-108176342 CAGGGGCGAGAGATGAAAGAGGG - Intronic
1101901461 12:108794079-108794101 CAGGGTCCAGAGAACAGGGCCGG - Intronic
1102258717 12:111430593-111430615 CAGGGTCCAGGGGCGAAGGGTGG + Intronic
1102716337 12:114976227-114976249 CAAGGTTCAGAGAGGAAGAAGGG + Intergenic
1102900220 12:116630859-116630881 CAGGGTCCAGGGAGGAAGGAGGG + Intergenic
1102915632 12:116750032-116750054 CCGCGTCCAGGGAGGAAGGAGGG + Exonic
1103851872 12:123938634-123938656 CAGGGGCCAGGCAAGGAGGATGG - Intronic
1104235825 12:126935681-126935703 CACAGTGCAGAGAAGAAGAAAGG + Intergenic
1104305349 12:127605532-127605554 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
1104550707 12:129754516-129754538 CAGGGACCAGACAAGAAGATGGG + Intronic
1104578324 12:129989105-129989127 CAGGGTCCAGAGATAAGAGATGG + Intergenic
1104704385 12:130932489-130932511 CAGGGTACAGGGGACAAGGAGGG - Intergenic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1105067165 12:133210653-133210675 CCGGGTCCTGAGTAGAAGCAAGG + Exonic
1105067189 12:133210775-133210797 CCAGGTCCTGAGTAGAAGGAAGG + Exonic
1105325048 13:19363250-19363272 GGGAGGCCAGAGAAGAAGGAGGG + Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105878964 13:24586756-24586778 CAGGAACAAGAGAAGAATGATGG + Intergenic
1105920874 13:24962294-24962316 CAGGAACAAGAGAAGAATGATGG - Intergenic
1106169363 13:27275685-27275707 CAGGGACCAGAGAATAAAGCTGG - Intergenic
1106208844 13:27622106-27622128 CGGGGCGCAGAGAAGAAGCATGG + Intronic
1107644547 13:42480173-42480195 CAGGTTCCACATCAGAAGGAAGG - Intergenic
1108092099 13:46859633-46859655 CATGGCCCAGAGCAGGAGGAAGG - Intronic
1110653073 13:77964628-77964650 TGGGGTGCGGAGAAGAAGGAGGG + Intergenic
1110804420 13:79737270-79737292 AAAGGTCCACAGAAGAAGTATGG + Intergenic
1110932719 13:81242805-81242827 GAGTGTCAAGAGAAGAAGGGAGG - Intergenic
1111554874 13:89867643-89867665 CAGGGTTGAGAGTAGAAGAAAGG - Intergenic
1112599351 13:100840024-100840046 CAGGTTCCAGAGAGGATGAAGGG - Intergenic
1112938457 13:104830156-104830178 CTGGGTTTAAAGAAGAAGGAAGG - Intergenic
1114220176 14:20689341-20689363 CAGGTTGAAGGGAAGAAGGAAGG + Intronic
1114404226 14:22440136-22440158 TAGGGTCAAGAGAAGAGTGAAGG - Intergenic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1114422807 14:22598590-22598612 CAGAGGCCAGAGGAGAATGAGGG - Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116265808 14:42688098-42688120 GAGGGCTCAGAGAAGAAGGTAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117044961 14:51804040-51804062 CTGTGGCCAGAGAAGATGGAAGG - Intergenic
1119123144 14:72098332-72098354 CAGGGGACAGAGAAAAAGCAAGG - Intronic
1119535803 14:75401598-75401620 CAGGAGCCAGGGAAGAAGGGCGG + Intergenic
1119862416 14:77946018-77946040 AAGTGTCCAGAGAACCAGGATGG - Intergenic
1120486630 14:85122385-85122407 CAAGTCCCAGGGAAGAAGGAAGG - Intergenic
1121020990 14:90580027-90580049 CAGGCCCCAGGGAAGAAGGAGGG - Intronic
1121055832 14:90851670-90851692 AAGGGTTCAGGGAAAAAGGAAGG + Exonic
1121073066 14:91042764-91042786 CATGGTCCTGAGAAGGGGGATGG - Intronic
1121954820 14:98204356-98204378 CAGGGGCCAGAGTGGAAGGTGGG + Intergenic
1122044538 14:99013934-99013956 TAGGGTCCAGTGGAGAAGGCAGG + Intergenic
1122790706 14:104183065-104183087 CGGGGTCCAGACAGGGAGGACGG - Intergenic
1122819749 14:104335475-104335497 CGGGGTTGAGAGAAGAGGGAGGG - Intergenic
1123721406 15:23064709-23064731 AAGGGGCCAGAGAAGAAAGCTGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1125357299 15:38829929-38829951 CCAGTGCCAGAGAAGAAGGATGG - Intergenic
1126131561 15:45347021-45347043 CAGGGACCAGAGAAGGAAAAGGG - Intergenic
1126443088 15:48712797-48712819 CAGGATCCAGGAAACAAGGATGG - Intergenic
1126909669 15:53404377-53404399 CAGAGTACAGAGAAGAAGACTGG - Intergenic
1127399871 15:58574926-58574948 CAGGGCCAAGAGATGAGGGAGGG - Intergenic
1127556076 15:60088975-60088997 CAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1127657429 15:61069486-61069508 CAGCGTCCAGGGAAAGAGGAAGG + Intronic
1127803171 15:62494923-62494945 CCGGGAACAGAGAAAAAGGAGGG - Intronic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130552458 15:84899317-84899339 AAGTCTCCAGAGGAGAAGGAGGG + Intronic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1131599885 15:93836596-93836618 CAGGCTTCAGAGAGAAAGGATGG + Intergenic
1131600779 15:93846679-93846701 GAGGTTGCAGAGAAAAAGGAAGG + Intergenic
1131779791 15:95843831-95843853 CAGGGTGAAGGGAAGATGGATGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132203108 15:99968675-99968697 CTGGGGCCGGAGAAGATGGATGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132626650 16:894562-894584 CAAGGCGCAGAGAGGAAGGACGG + Intronic
1133617849 16:7495448-7495470 GAGGCTGCAGAGAAAAAGGATGG - Intronic
1133681094 16:8120566-8120588 CAGGGTTCAAAGCAGAAGCAAGG - Intergenic
1133685947 16:8165704-8165726 CTGGGTCCAGAGGCCAAGGACGG + Intergenic
1133972201 16:10576571-10576593 CTGGGTCCAGAGCTGAGGGAGGG - Intronic
1134007168 16:10825745-10825767 GAGGGCCAAGGGAAGAAGGAGGG + Intergenic
1134012227 16:10863384-10863406 CTGGCTTCAGAGATGAAGGAAGG - Intergenic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1136751127 16:32637197-32637219 CAGAGTACAGATAAAAAGGAAGG - Intergenic
1138032736 16:53573331-53573353 AAGGGTCCAGAGCTGATGGAAGG - Intergenic
1138157386 16:54718691-54718713 CAGGGTCTAGGGAGGAAGCATGG + Intergenic
1138510244 16:57504547-57504569 CAGGGGCCTGAGAGGAAGCATGG + Intergenic
1139403925 16:66703473-66703495 CATGGTCCACAGAAGAGGGTAGG + Intergenic
1139980770 16:70857082-70857104 CAGGGTAGGGAGAATAAGGAAGG - Intronic
1140355857 16:74305605-74305627 CGGGATGCAGAGAAGAAAGAAGG + Exonic
1140504557 16:75463569-75463591 GAGGGACCAGAGCAGAGGGAAGG - Intronic
1140512102 16:75516352-75516374 GAGGGACCAGAGCAGAGGGAAGG - Intergenic
1141476034 16:84274121-84274143 CAAGGTCCTTATAAGAAGGAGGG - Intergenic
1141495414 16:84406423-84406445 CAGGGGCCAGAGAATGAAGAAGG - Intronic
1141575888 16:84963415-84963437 CAGGACCTAGAGAGGAAGGAGGG - Intergenic
1141864508 16:86740919-86740941 AAGGGCCCAGAGAAGAGGCACGG - Intergenic
1141964605 16:87433348-87433370 CAGAGCCCAGAGAGGAAGGCGGG + Intronic
1203053261 16_KI270728v1_random:896452-896474 CAGAGTACAGATAAAAAGGAAGG - Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142698636 17:1646755-1646777 CCAGGGCCAGAGAAGCAGGAGGG + Intronic
1143305941 17:5946797-5946819 AAGGGTGGAGAGGAGAAGGATGG + Intronic
1143381505 17:6499106-6499128 GGGGGTCCAGAGAAGAGAGAGGG - Intronic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1144992869 17:19245963-19245985 CAAGGTCAAGAGATGAAGAAGGG - Intronic
1145900029 17:28484663-28484685 CAGGGTCAAGAGAGGAAGCTGGG + Intronic
1147314048 17:39611122-39611144 CAGGGTCCAAGGGAGAAGGCAGG - Intergenic
1147485120 17:40805354-40805376 AAGGGTCCTTAGAAGGAGGAAGG + Intergenic
1147882485 17:43663002-43663024 CATGGCCCAGAGCAGCAGGATGG + Intergenic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1148388494 17:47253680-47253702 CAGGGTCTAGAGAAGCGCGAGGG + Intergenic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1148835734 17:50464848-50464870 CAGTGTCCTGGGGAGAAGGAAGG - Exonic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149387111 17:56153315-56153337 CAGGGTCAAGAGGAGAGGCAGGG - Intronic
1149559498 17:57598181-57598203 CAGCCTCAAGAGAAGAGGGAGGG + Intronic
1150134974 17:62690550-62690572 CAGGCTGCAGAGAAGAGGGCTGG + Intronic
1151251621 17:72840342-72840364 AAAGGTCCAGAGAAGAGGGTAGG - Intronic
1151299889 17:73216404-73216426 CAGGATCCAGAGAGTAAGGGAGG + Intronic
1151878626 17:76881427-76881449 GAGGGTCCAGGGAAGAGGGATGG + Intronic
1152267847 17:79306654-79306676 GAGGGTGCAGGCAAGAAGGAAGG + Intronic
1152715096 17:81895671-81895693 CAGGGTCAAGAGATCAAGGCAGG + Intronic
1153268647 18:3296831-3296853 CAGGCTCCAGTGAGGATGGAGGG + Intergenic
1153582438 18:6587968-6587990 AAGGCTCCAGAGAAAAGGGAAGG + Intronic
1154113336 18:11589559-11589581 CAGGCTCCACAGATCAAGGATGG + Intergenic
1154395673 18:13986290-13986312 AAGGTTGCAGAGAAAAAGGAAGG + Intergenic
1155064612 18:22257663-22257685 GAGGACCCAGAGAAGAAGGATGG + Intergenic
1155231665 18:23780315-23780337 CAGGGTGAAGGAAAGAAGGAAGG + Intronic
1156048791 18:32907113-32907135 GAGGGGCTAGAAAAGAAGGAGGG - Intergenic
1156048795 18:32907131-32907153 GAGGGGCTAGAAAAGAAGGAGGG - Intergenic
1156389946 18:36640996-36641018 CATGTTGCAGAGAAGAAGGATGG - Intronic
1157439195 18:47697130-47697152 CAGGGCACAGAGAAGAGGGTGGG - Intergenic
1157614279 18:48977581-48977603 CAGGGTCCAGAGAGGCCGGTAGG - Intergenic
1157643392 18:49241713-49241735 CAGGGTAGGGAGAAAAAGGAGGG + Intronic
1157888337 18:51390127-51390149 AAGGGTGGAGAGAAGAAGGCAGG - Intergenic
1158637579 18:59175184-59175206 CAAAGTCCAGAGGACAAGGATGG + Intergenic
1159398480 18:67897290-67897312 CATGACCCAGAGACGAAGGAAGG + Intergenic
1160226043 18:77011630-77011652 CAAGGGCCAGAGAAGACGAAAGG + Intronic
1160357264 18:78238979-78239001 CGGCGGCCTGAGAAGAAGGAAGG + Intergenic
1160754604 19:750986-751008 CAAAGTCCAGAGGAGGAGGAGGG - Intergenic
1161301389 19:3544600-3544622 GGGGGTCCAGAGAAGAGTGAGGG + Exonic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1162032822 19:7924837-7924859 CAGGGACCAGAGCCCAAGGACGG + Exonic
1162594780 19:11619911-11619933 CAGTGTTCAGAGAATAAGTAAGG - Intergenic
1162994978 19:14328909-14328931 CAGAGTGCTGACAAGAAGGAGGG + Intergenic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163703193 19:18797121-18797143 CAGGGAGGAGGGAAGAAGGAAGG - Intergenic
1163830880 19:19546670-19546692 CAGGCTCTAGGGAGGAAGGATGG + Intergenic
1163966709 19:20753018-20753040 GAGGCTCCAGACAAGGAGGAAGG - Intronic
1164684157 19:30156152-30156174 CTGGGCCCAGAGCAGAAGGAGGG - Intergenic
1164816897 19:31211322-31211344 CAGGTTGCAGAGATGAGGGAGGG + Intergenic
1164846694 19:31438608-31438630 CAGGGTCCAGAGGGCAAGGCTGG + Intergenic
1164850455 19:31478831-31478853 CAGGGTCCAGGGAAGGATCAGGG + Intergenic
1164905191 19:31961378-31961400 CATGGTGCACAGAAGAAGGGAGG - Intergenic
1165962546 19:39547502-39547524 CAAGGGGAAGAGAAGAAGGATGG - Intergenic
1166109869 19:40615129-40615151 CAGGCTCCAGCGAGGCAGGAGGG + Intronic
1166508433 19:43387497-43387519 CAGTGTCCAGAGAAGAGAGGTGG - Intergenic
1166919198 19:46217269-46217291 CAGGGTCTAGAGAAAAGAGAAGG + Intergenic
1167594411 19:50419580-50419602 CTTGGACCAGAGGAGAAGGATGG - Intronic
1167640792 19:50680279-50680301 AAGAGCCCAGAGAGGAAGGAGGG + Intronic
1167777916 19:51573369-51573391 CTGGGTCCAGAGAAGCAGGATGG + Exonic
1168058025 19:53874287-53874309 GAGGGGCCAGAGAACAAGGGCGG - Exonic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925270657 2:2604882-2604904 CAGCGCCCAGGGTAGAAGGATGG - Intergenic
925542324 2:4979303-4979325 CTGGGCTCAGAGAAGCAGGAAGG - Intergenic
925672199 2:6323235-6323257 AAGGCTGCAGAGAAGAGGGAAGG + Intergenic
926073638 2:9922566-9922588 CAGGGGACAGAGAATAATGAGGG - Intronic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926690859 2:15732446-15732468 CAGTTTCCAAAGAGGAAGGAAGG + Intronic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927840205 2:26436788-26436810 CAAGGCCAGGAGAAGAAGGAGGG + Intronic
927884555 2:26710479-26710501 CAGGCTTCAGAGAAGAGGGGAGG + Intronic
927927422 2:27023688-27023710 CAGGGTCCAGAGAGGAGGAAGGG - Intronic
928404294 2:31002802-31002824 CAAGTTCCAGTGAGGAAGGAGGG + Intronic
928608381 2:32965482-32965504 CAGGGTTTAGACAGGAAGGAGGG - Intronic
928844368 2:35651988-35652010 CAGAGGCCTGAGAAGCAGGAGGG - Intergenic
929439651 2:41955193-41955215 CAGGGCCCAAAGGTGAAGGAGGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930113853 2:47701976-47701998 AAGGGCCCAGAAAAGAAGGCAGG + Intronic
930175437 2:48296634-48296656 GAGGGACCAGAGAAGAGGTATGG + Intergenic
930237260 2:48900245-48900267 GAGGATCCAGAGAAAATGGATGG - Intergenic
932374603 2:71224680-71224702 CAGGGTGCAGAGAAGCACGATGG - Intronic
933639053 2:84740448-84740470 CAGGGCACTGAGAAGAAGGGTGG + Intronic
933660071 2:84920427-84920449 CAAGGTCAGAAGAAGAAGGATGG - Intergenic
933704176 2:85277540-85277562 AGGGGTCCAGAGAGGCAGGAAGG + Intronic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
935070918 2:99692685-99692707 TAGGGTTCAGAGAAGAGGGAAGG - Intronic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935862313 2:107346500-107346522 CTGAGTCCAGAGAAAAAGTATGG - Intergenic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
938081187 2:128371034-128371056 GAGGGACCAGAGAAGGAGGACGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938376218 2:130808403-130808425 CAGGGTGCAGAGAAGAGAGGTGG - Intergenic
938843175 2:135182294-135182316 CAGGGTCAGGACAAGAAGCAGGG + Intronic
939650635 2:144757876-144757898 CAGGGTGTGGGGAAGAAGGAGGG - Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940092729 2:149938947-149938969 GAGGCTGCAGAGCAGAAGGAGGG - Intergenic
940838795 2:158555240-158555262 CAGGCTTCAGAGAAAAAGAACGG - Intronic
940854789 2:158721623-158721645 CAGGGTCCAGTGAGGAGGGGAGG + Intergenic
941456668 2:165717465-165717487 TATAGTCCAGAGGAGAAGGATGG - Intergenic
942994554 2:182245513-182245535 CAGGGACCAGAGGTGAGGGAAGG - Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944136627 2:196406637-196406659 GTGGGTTCAGAGAAGAAGGTTGG - Intronic
945660729 2:212682134-212682156 GAGGCTCCAGAGAGAAAGGAGGG + Intergenic
945829101 2:214761260-214761282 CATGTTCCAGAGAAGAGGAAAGG + Intronic
945980169 2:216303513-216303535 CAGGGTCCTGAAATGAAGTATGG + Intronic
946033553 2:216724120-216724142 CAGGGTGCAGAGAAGTAGCCAGG + Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946313780 2:218896928-218896950 CAAGGTCCAGAGAGGAATCATGG - Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
947095732 2:226564510-226564532 TAGTGTCCAAAGAAGAAGAAAGG - Intergenic
947594637 2:231403300-231403322 GAGGTTCCAGACAAGGAGGAAGG + Intergenic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
947898119 2:233694223-233694245 CAAGGTCCAGAGACAAAGCATGG - Intronic
948075747 2:235164061-235164083 CAGGGTCCAGTGCAGCAGGGTGG + Intergenic
948784637 2:240346043-240346065 GAGGGTCGATAGAAGAAGGAAGG - Intergenic
948790527 2:240374339-240374361 AAGGGACCAGAGAAGGAGGATGG + Intergenic
1169789157 20:9391599-9391621 CAAGTTCGAGGGAAGAAGGAAGG - Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1171004763 20:21453656-21453678 CAGGTTCCAGAGAAGACAGCAGG + Intergenic
1171113044 20:22501698-22501720 CAGGGTCCAGTAAAGCAGGATGG - Intergenic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1171408189 20:24928065-24928087 CAGGCCCCAGACAAGGAGGATGG + Intergenic
1172189871 20:33055452-33055474 CAGGCCCCAGAGCAGAAGCAGGG - Exonic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1174057111 20:47805750-47805772 CAGGGTCCAGAGAACGGAGAGGG + Intergenic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174198496 20:48790421-48790443 CAGGCTCCAAGGAAAAAGGAGGG + Intronic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1174914216 20:54638162-54638184 CATGGTCTAGAGCAGAAGGAAGG + Intronic
1175780690 20:61680244-61680266 CAGGATCCAGACCATAAGGAGGG + Intronic
1176054116 20:63135186-63135208 CAGGGCCCAGAGAGGAGGCAGGG + Intergenic
1176740301 21:10595521-10595543 CAGGAACAAGAGAAGAGGGATGG + Intronic
1176957623 21:15124324-15124346 CAGGAGACAGGGAAGAAGGAGGG + Intergenic
1177567496 21:22843894-22843916 CAGGTTCCAGAGATGAAGGAGGG + Intergenic
1178661718 21:34512076-34512098 CACGGTCGAGAGGAGTAGGAAGG + Intergenic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1179942994 21:44651619-44651641 CAGGGTCCTTATCAGAAGGAGGG - Intronic
1180052267 21:45336574-45336596 CAGGGGCCAGAGATGAATGCTGG - Intergenic
1180898546 22:19354558-19354580 AAGGGTCCAGAGAAGGTGGAAGG - Intronic
1181542382 22:23580309-23580331 CAGGGACCAGAGGATGAGGATGG - Intergenic
1182094086 22:27614547-27614569 GATGGTCCCGAGAAGAGGGACGG + Intergenic
1183323015 22:37176549-37176571 CAGGAGCCAGAGAGGAAGGAGGG - Intergenic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184232580 22:43166593-43166615 CAGGGTCCAAAGAGAAAGGAGGG + Intergenic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184858710 22:47161006-47161028 CAGGGTGCTGGGAAGAAGGGGGG + Intronic
1184885152 22:47339847-47339869 CAGCGTCCAGAGAGGAAAGGTGG - Intergenic
1185235717 22:49711780-49711802 CATGTTCCAGGGAAAAAGGAAGG + Intergenic
1185276726 22:49953121-49953143 CTGGCTCCAGAGCAGAGGGAAGG + Intergenic
949561082 3:5203201-5203223 CAGAGCCCAGAGAAGATGAAAGG - Intronic
950031755 3:9858424-9858446 CAAGCTCCAGAGAAGAGGCAGGG + Intergenic
950086267 3:10260226-10260248 CAAGGTCCAGAAAAGGAAGAGGG + Exonic
950183039 3:10928362-10928384 CAGGGCGCAGAGGAGAGGGATGG + Intronic
950485414 3:13270490-13270512 CAGGCCCCAGAGAAGAAAGCTGG - Intergenic
950681496 3:14588363-14588385 CAGTGTCCAGAGAAGGAGAGAGG - Intergenic
951778421 3:26336179-26336201 CAAGGCCCAGTGAAGAAGAAAGG + Intergenic
952560500 3:34587249-34587271 GAGGGTGGAGAGTAGAAGGAGGG - Intergenic
953090381 3:39718915-39718937 CAGGCTCCAGAGAGAAAGGAAGG - Intergenic
953837432 3:46359007-46359029 CAGGGCTGAGAGGAGAAGGAGGG + Intronic
954266813 3:49476042-49476064 CAGGGTCCAGGGTAGAAAGATGG + Intronic
954272173 3:49518544-49518566 CAGGGTCAGGAGAATAAAGAAGG + Intronic
954610741 3:51943389-51943411 GAGGGCCCTGAGAAGAAGAAGGG + Exonic
954787411 3:53104098-53104120 CTGGGGCCAGGGAAGAGGGAAGG + Intronic
955150280 3:56360355-56360377 CAGAGTCTAGAGAAGTAGAAGGG - Intronic
955747963 3:62158655-62158677 CAGGTTCCCTAGAAGAAGGTAGG + Intronic
956186633 3:66568831-66568853 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956531815 3:70228952-70228974 CAGAGTCCAGTGAAGAAACACGG + Intergenic
958017348 3:87955211-87955233 CAGAGTCCAGAGACAAAGGCAGG - Intergenic
960526920 3:118720563-118720585 CAGGCTCCACAGAAGAACGGAGG - Intergenic
960611909 3:119562509-119562531 CAAGGTCAAGAGCAGAAAGATGG - Intergenic
961253697 3:125527602-125527624 CAGGGCCCAGAGAGTAAGGAAGG - Intergenic
962169672 3:133087748-133087770 CAGGTTCCAGGGAAGAAAGATGG - Intronic
963262087 3:143203036-143203058 CATTTTCCAGAGAATAAGGATGG - Intergenic
964517680 3:157530605-157530627 CAGGATCCAGAGAAGAGTGCTGG + Intronic
965434415 3:168631089-168631111 TAGGGTGCAGAGAAAAGGGAAGG - Intergenic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
966289089 3:178334135-178334157 GAGGGGCCAGAGAACAAGGCTGG - Intergenic
967268634 3:187714521-187714543 CTGGCTCCAGGGAAGCAGGAAGG - Intronic
967490763 3:190088619-190088641 CAGAGACCAGATCAGAAGGAGGG + Intronic
967790545 3:193544108-193544130 AAGAGTCCAGAGAAGTAAGAGGG - Intronic
968282445 3:197487273-197487295 GAGGGTACAGGGAAGCAGGAGGG + Intergenic
968643197 4:1725348-1725370 CAGGGCCCAGAGAAGGATGTAGG - Intronic
968752435 4:2396988-2397010 CAGGAGCCAGGGCAGAAGGAAGG + Intronic
968836285 4:2966891-2966913 CAGGGACCAGAGAGGGAGGGGGG - Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969387776 4:6867305-6867327 GAGTGTCCAGAGTAGAAGGACGG + Intronic
969725947 4:8918123-8918145 CAGTGCCCAGAGAAGCAGGCAGG + Intergenic
969749576 4:9100009-9100031 GAGGCTCCAGACAAGGAGGAAGG + Intergenic
969884084 4:10199947-10199969 CTGGATCCAGAAAAGCAGGAAGG - Intergenic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
970959341 4:21854791-21854813 CAGAGTCCAAAGAAGAAATAGGG - Intronic
972169207 4:36324245-36324267 GAGGGGCCAGAGAAGGAGAAAGG - Intronic
972330043 4:38056135-38056157 CAGAGACCAGAGAAGAAGCCAGG - Intronic
973150976 4:46887827-46887849 CAGGGTGCAGAGCAGAATGAGGG - Intronic
973832755 4:54778669-54778691 CAGGTTACAGAAAAGAAGGCAGG - Intergenic
979108601 4:116720299-116720321 AAGGGAGCAGAGAAGAAAGAAGG - Intergenic
979774983 4:124579210-124579232 CAAAGACCAGAGAAAAAGGATGG + Intergenic
980685242 4:136219510-136219532 AAGGGGCCAGAGAAAAAAGATGG - Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
980965599 4:139517823-139517845 CAGGGCCCTGAGACGGAGGAGGG - Intronic
981571468 4:146155857-146155879 CAGGTTCCAGAGAGTAAGGCTGG - Intergenic
981627562 4:146776606-146776628 CAGGGGCCAGAGAACAAAGTTGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984127925 4:175835169-175835191 TAGGGTCCAAAGGAGAAGCACGG - Intronic
984144664 4:176045747-176045769 CAAGGGCAAGAGAAGAAGGGAGG + Intergenic
984189579 4:176589354-176589376 AAGAGTACAGAGCAGAAGGAAGG + Intergenic
984627918 4:182029183-182029205 CAGGATCAAGAGAACAAGCAGGG + Intergenic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
985344408 4:188987985-188988007 CAGGGTCCAGGGGAGAATAAGGG - Intergenic
985547121 5:515312-515334 CAGGGGCCTGAAAGGAAGGAGGG - Intronic
985984594 5:3504180-3504202 CTGGGGTCAGAGAAGAAGAAGGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986616179 5:9619596-9619618 CAGGTTCCAGATAAGAAGACAGG - Intergenic
987509160 5:18814022-18814044 CAGGGTTCAGATGAGAAGGCAGG + Intergenic
988619429 5:32807695-32807717 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
988848449 5:35154501-35154523 GAGGTTGCAGAGAAAAAGGAAGG + Intronic
989716305 5:44467689-44467711 GAGAGGCCAGAGAAGAAAGATGG - Intergenic
990155690 5:52874606-52874628 TTGGGTGCAGAGAAGAAAGAGGG - Intronic
992732818 5:79689823-79689845 CAGGGGCCAGAGCAGTCGGAGGG + Intergenic
994037765 5:95222211-95222233 CAGTGTGGAGAGAAGAAGGCAGG - Intronic
995928679 5:117408256-117408278 CAGGGTGGAGAGTGGAAGGAGGG - Intergenic
996249931 5:121317224-121317246 CAGGGGCCAGAGAACAAAGCTGG - Intergenic
996401407 5:123067230-123067252 CAGGGGCCAGAGAAAGGGGATGG - Intergenic
996455044 5:123672009-123672031 AAGGGGCCAGAGGAGAAGAAGGG - Intergenic
996801271 5:127406284-127406306 CAGGGGCCAGAGAAAGAGAAGGG + Intronic
997799336 5:136844024-136844046 CTGGATCCAGTTAAGAAGGAAGG - Intergenic
997805952 5:136918028-136918050 CATGGTCTAGGGAAGGAGGAAGG - Intergenic
997940248 5:138150919-138150941 CTGGTACCAGACAAGAAGGAAGG - Exonic
998418263 5:141960820-141960842 AAGGGAACAGAGAAGAGGGAGGG + Intronic
999574655 5:152962495-152962517 CAAGGCACAGAGAAGAAGCATGG - Intergenic
1000974612 5:167751106-167751128 CAGGGTGGAGAGAGGAAGCAGGG + Intronic
1000992790 5:167928110-167928132 CATACCCCAGAGAAGAAGGAGGG - Intronic
1001108390 5:168875212-168875234 GAGGGAAGAGAGAAGAAGGAAGG + Intronic
1001208611 5:169788983-169789005 GAGGGTGGAGAGTAGAAGGAGGG - Intronic
1001321333 5:170684691-170684713 CAGTGACCAGGGATGAAGGAGGG - Intronic
1001692161 5:173641326-173641348 CAGGGTCCTGAGAAGGAGAAGGG - Intergenic
1001700666 5:173704556-173704578 CTGGGCCCAGGGTAGAAGGAGGG - Intergenic
1001764493 5:174234688-174234710 TAGGGCCCAGTGAAGAAGGAAGG + Intronic
1001992692 5:176131406-176131428 CAGAGTACAGACAAAAAGGAAGG - Intronic
1002002412 5:176204872-176204894 CAGAGTACAGACAAAAAGGAAGG - Intergenic
1002067965 5:176661794-176661816 CTGGGTCCAGGAAGGAAGGAAGG + Intergenic
1002224186 5:177706739-177706761 CAGAGTACAGACAAAAAGGAAGG + Intergenic
1002322106 5:178382422-178382444 CAGCCTCCAGAGGAGGAGGAGGG - Intronic
1003535105 6:6969793-6969815 GAGGGGCCAGAGATGAAGAAAGG - Intergenic
1005083457 6:21980603-21980625 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083557 6:21981131-21981153 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005360644 6:25027907-25027929 CAGAGCCCAGCCAAGAAGGATGG - Intronic
1006021754 6:31121522-31121544 CAGGGGCCAGAGCAGGAGGGAGG - Intronic
1006044677 6:31284340-31284362 CAGTGTCCAGAAAAGAAGATGGG + Intronic
1006602793 6:35237139-35237161 AAGAATCCAGAGGAGAAGGAAGG - Intronic
1006679808 6:35788677-35788699 GAGGGACAAGAAAAGAAGGAAGG + Intronic
1007399157 6:41593943-41593965 CAGGGTCCAGGGATGCAGGCAGG + Intronic
1008508612 6:52255402-52255424 CGGGGTCCAGAGCAGAAGGCAGG + Intergenic
1008565664 6:52765884-52765906 CAGGAGCCAGAGCATAAGGAAGG + Intergenic
1009286803 6:61828671-61828693 CAAGGGGCAGAGAAGAATGAGGG - Intronic
1009312395 6:62170775-62170797 AAGGGGCCAGAGAACAAAGATGG + Intronic
1009813454 6:68700050-68700072 CAGGGTCGAGAGGAGAAAAAGGG + Intronic
1010330131 6:74613965-74613987 GAAGGTGGAGAGAAGAAGGAGGG - Intergenic
1010435610 6:75826601-75826623 CAGGCTCCAGGGGACAAGGATGG + Intronic
1010470147 6:76217609-76217631 CAGGGTCCAGAGGTGAAGGGTGG - Intergenic
1010839818 6:80635682-80635704 CATGTTCTAGACAAGAAGGATGG + Intergenic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012883698 6:104820701-104820723 AAGGTTGCAGAGAAAAAGGAAGG + Intronic
1012924500 6:105254007-105254029 CAAGGGCAAGAGAAGATGGATGG - Intergenic
1012935013 6:105358613-105358635 CAGCCACCAGAGAAGAAGCATGG - Intronic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1015660402 6:135567879-135567901 CAAGGTCCAGAGAAAAAGGGTGG - Intergenic
1015992638 6:138962774-138962796 GAGAGTCCAGAGAATAAGGAAGG + Intronic
1016648632 6:146438845-146438867 CAGAGCCCAGGGAAGAATGATGG + Intergenic
1017071086 6:150576156-150576178 CAGGGCCCTGAGTAGAAGGTGGG - Intergenic
1017110801 6:150930613-150930635 CAGTGTTCAGAGAAAAAGGCAGG - Intronic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1017887549 6:158611437-158611459 CAAGGTCCAGAAAAGGAAGACGG - Intronic
1018251592 6:161877252-161877274 CAGGGTCCAGACAGGAGGAATGG - Intronic
1018347669 6:162919333-162919355 CAGGGTCCAGATACGAAGTTGGG + Intronic
1018471228 6:164100375-164100397 CTGGGACCACAGGAGAAGGAAGG - Intergenic
1018868452 6:167763293-167763315 CAACGACCAGAGAAGAGGGAAGG - Intergenic
1019144976 6:169970673-169970695 CAGGCTCCAGATCAGAAGGACGG - Intergenic
1020323410 7:6956632-6956654 GAGGCTCCAGACAAGGAGGAAGG - Intergenic
1021798383 7:24280460-24280482 CAGGCTACAGTGCAGAAGGAAGG + Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1023024113 7:36035627-36035649 CTGGGTCCAGAGCAAAAGCATGG - Intergenic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1024002493 7:45199882-45199904 GAGAGCCCTGAGAAGAAGGAGGG - Intergenic
1025941106 7:66076614-66076636 CAGGGTCCAGTGAGACAGGAAGG - Intronic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026282333 7:68933080-68933102 CAGGGTAGAGGGAGGAAGGAAGG - Intergenic
1026307571 7:69154973-69154995 CAAAGTCCAGAGGAGAGGGAAGG - Intergenic
1026358159 7:69578032-69578054 CAGGTTCCAGAGAAGATTGGTGG - Intergenic
1026479032 7:70763072-70763094 CAGGGTCCGGAGAAGGAGCTCGG - Exonic
1026483872 7:70801113-70801135 GATGGTCCAGAGAAGAGAGATGG - Intergenic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1026804001 7:73418252-73418274 CCAGGTGCAGGGAAGAAGGAAGG + Intergenic
1026955235 7:74372634-74372656 CAGGGGCCAGCGAGGGAGGATGG + Intronic
1027367490 7:77473563-77473585 CACAGTACAGAGAAGAGGGAAGG + Intergenic
1027485574 7:78757425-78757447 CAGGAGCCAGAGAGGAAAGAGGG - Intronic
1028457100 7:91050266-91050288 TGGGGGCCAGAGAAGAAGCAGGG + Intronic
1028581384 7:92413062-92413084 CAGGGTCCAGGGAATAATGGCGG + Intergenic
1029352400 7:100023549-100023571 CAGGCTGCACAGGAGAAGGATGG + Exonic
1030173440 7:106627632-106627654 CTGGCACCAGGGAAGAAGGAGGG + Intergenic
1030672324 7:112351512-112351534 GAGGGTCCAGAGAGGAAGGAGGG - Intergenic
1030761166 7:113353716-113353738 CAGGGGCTGGAGAAGAAGTAGGG - Intergenic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1033228988 7:139582231-139582253 CTGGGGCCAGAGAAGCAGGCTGG - Intronic
1033234179 7:139625138-139625160 CAGGGTTCAGAGCACAGGGATGG - Intronic
1033527948 7:142234883-142234905 GAGGGGCCAGAGAAGAAAGCTGG + Intergenic
1033939902 7:146639865-146639887 CAGAGTCCGAAGAAGAGGGAAGG + Intronic
1033977240 7:147116882-147116904 AAGAGTCCAGACAAGGAGGAAGG - Intronic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034257574 7:149733076-149733098 CAGCTTCCAGAAAGGAAGGAAGG - Intronic
1034270005 7:149798808-149798830 CAGGGGCTGGAGAGGAAGGAGGG + Intergenic
1034416874 7:150969965-150969987 CAGGGTCAGTAGAAGAGGGAGGG - Intronic
1034979381 7:155466598-155466620 CTGGGTGCAGCGGAGAAGGAGGG - Intergenic
1035170662 7:157015610-157015632 CAGGGTCCAGGGAAGCTGGGAGG - Intergenic
1035466115 7:159079032-159079054 CAGTGTCCATGGAGGAAGGATGG + Intronic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1035841212 8:2813607-2813629 CAGAGTCCAGAAAGGAAGGCCGG + Intergenic
1035856974 8:2986030-2986052 CCGTCTCCATAGAAGAAGGAAGG + Intronic
1036205414 8:6802124-6802146 CTGGGACCAGGGAAGAAGGGCGG - Intergenic
1036497107 8:9279486-9279508 CAGGGACCAGAGAAGAGACAGGG + Intergenic
1036726426 8:11224793-11224815 CAGAGTCCAGAGCAGTAGGCTGG - Intergenic
1037316727 8:17606389-17606411 CATGCTCCAGATAAGAATGAAGG - Intronic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037513728 8:19609677-19609699 AAGGACCCAGAGAAGCAGGAGGG + Intronic
1037734396 8:21555108-21555130 CAGCTTACAGAGGAGAAGGAGGG + Intergenic
1037833966 8:22205372-22205394 CAGGGTGCAGAGGAGCAGGCTGG + Intronic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1038798763 8:30731156-30731178 GAGGCTCCAGACAAGGAGGAAGG + Intergenic
1039858754 8:41438450-41438472 CTGGGTCCAGTAATGAAGGAAGG + Intergenic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1041767560 8:61434837-61434859 CCGGGTCTAGAGAGAAAGGAAGG + Intronic
1041963096 8:63642586-63642608 CAGTCGCCAGAGATGAAGGAGGG - Intergenic
1042155745 8:65842197-65842219 CAGGGTGCAGAACACAAGGAAGG - Intronic
1043137655 8:76548694-76548716 CAGGGGCAAGAGAGAAAGGAGGG + Intergenic
1044297545 8:90546157-90546179 CAGGCTGCAGGGAAGAATGAAGG + Intergenic
1044867875 8:96590207-96590229 CAGGGTCCAGAGTACAAGCTGGG - Intronic
1044923138 8:97186714-97186736 CAGGGAACAGAGAAGTACGAAGG + Intergenic
1047175074 8:122532852-122532874 CAGGGTGGTGAGAACAAGGAGGG + Intergenic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047236475 8:123046370-123046392 GAGGGTCAAGAGACAAAGGAAGG + Intronic
1047762649 8:127965598-127965620 CAGAGTGGAGAGAACAAGGAAGG - Intergenic
1048048176 8:130792731-130792753 CAGGGTCAAGAGTGGAAGAAGGG - Intronic
1048206130 8:132416811-132416833 CAGGGTACAGACAGGAAGGCTGG + Intronic
1048315056 8:133355632-133355654 AAGGGGCCAGAGCAGAGGGAAGG + Intergenic
1048370152 8:133770131-133770153 CAGGGTACAGAGAGAATGGATGG - Intergenic
1048532759 8:135265334-135265356 AAGGGACCAGGGAAGCAGGAAGG - Intergenic
1048988376 8:139747614-139747636 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988409 8:139747733-139747755 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988441 8:139747851-139747873 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988470 8:139747969-139747991 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988502 8:139748088-139748110 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988534 8:139748206-139748228 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988563 8:139748324-139748346 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988592 8:139748443-139748465 CAGGGATCAGAGAAGATGCAGGG + Intronic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049352827 8:142173161-142173183 CAGGCTCACGAGGAGAAGGATGG + Intergenic
1049686947 8:143942820-143942842 CAGGGCCCAGGGAGGAAGGCAGG + Intronic
1049720440 8:144113085-144113107 CAGGGGCCAGGGAGGAAGGAAGG - Intronic
1049725606 8:144144317-144144339 CAGGCTCCAGTGGAGAAGGCCGG - Intergenic
1052367141 9:27625057-27625079 CTGGGTTTAGAGACGAAGGAGGG + Intergenic
1053227157 9:36369901-36369923 CAGGCGCCAGAGAGGAAGAAGGG - Exonic
1055324753 9:75117868-75117890 GAGGGTCAAGAGGAGAATGAAGG - Intronic
1056917536 9:90758253-90758275 GAGGGCCCGGAGAAGGAGGAAGG - Intergenic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057164694 9:92916436-92916458 CAGGGCTCAGACAAGCAGGAGGG + Intergenic
1057233765 9:93342508-93342530 CAGTGTCCAGAGAGGCAGGGTGG + Intronic
1057252080 9:93511515-93511537 CAGTGTCCAGAGAGGCAGGGTGG - Intronic
1057292462 9:93815355-93815377 CTGGGCACAGATAAGAAGGAGGG - Intergenic
1057317233 9:93977470-93977492 CAGGGCGCAGAGCAGAAGGAAGG - Intergenic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058832685 9:108833031-108833053 CAAGGTCCAGAGAGGATGGAAGG - Intergenic
1058978017 9:110142672-110142694 CAGGGTGTAGGGGAGAAGGAAGG + Intronic
1059018277 9:110545759-110545781 CAGGGTTCCAAGAAGAAGAATGG - Intronic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1060187961 9:121575352-121575374 CCAGGACCACAGAAGAAGGAAGG - Intronic
1060471681 9:123953001-123953023 CAGGGTCCGGGGAAGAGAGACGG - Intergenic
1060883765 9:127136412-127136434 CAGGGTCCCGGGAAGAGGGTGGG - Intronic
1061240150 9:129365427-129365449 CAGGGACCAGGGATGAAGGTAGG + Intergenic
1061545128 9:131299915-131299937 CAGGGCCCAGGGAAGAAAGGGGG + Intronic
1061649858 9:132038794-132038816 CAGGAGACAGGGAAGAAGGAAGG + Intronic
1061716597 9:132522132-132522154 CAGGGTCCAAGGACAAAGGACGG + Intronic
1061808339 9:133148736-133148758 CGGAGTCCAGAGATGAAGGGAGG - Intronic
1061898924 9:133663035-133663057 CAAGGGCCAGACAAGGAGGAGGG + Intergenic
1185837636 X:3360217-3360239 CAGGGTCCGTAGAAGAGGGAAGG - Intergenic
1187111407 X:16304792-16304814 CAGGATCCTGAGGAAAAGGAGGG + Intergenic
1187409939 X:19042381-19042403 TAGGTACCAGAGAAGAGGGATGG + Intronic
1187766036 X:22643403-22643425 CAAAGTCCAGATAAGAAGCAGGG + Intergenic
1187918993 X:24182827-24182849 CAGGTTCCAGAGAAGGGGAAGGG + Intronic
1188775792 X:34216721-34216743 GAGGGTGGAGAGTAGAAGGAGGG + Intergenic
1189038200 X:37514769-37514791 TAGGGTAGAGACAAGAAGGAGGG - Intronic
1189081614 X:37978873-37978895 GAGGTTCAGGAGAAGAAGGAAGG + Intronic
1189905354 X:45753719-45753741 CAAAGTCAAGAGATGAAGGAAGG + Intergenic
1189940562 X:46117056-46117078 GAGGGTCCAGAGAACAAAGTTGG - Intergenic
1191671298 X:63751145-63751167 AAGGGGCCAGAGAGGAGGGAAGG + Intronic
1191894515 X:65977664-65977686 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
1192084212 X:68079511-68079533 CAGTGTTCAGAGAAGCAGAAAGG - Intronic
1192244380 X:69360590-69360612 GAGGGGCAAGAGAAGAAGCAGGG + Intergenic
1192259210 X:69494128-69494150 CAGACTTCAGAGAAGAAAGAGGG + Intergenic
1193850915 X:86536495-86536517 CAGGCTCCAGAGAAAATAGATGG - Intronic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194400195 X:93432240-93432262 GAGGATCCAGACAAGGAGGAAGG + Intergenic
1194568058 X:95518871-95518893 CAGGTTGCGGAGAAAAAGGAAGG + Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195861314 X:109386332-109386354 AAGGGTCCAGTGGAGAAGGTAGG + Intronic
1196111641 X:111952907-111952929 CAGGCACCAGAAGAGAAGGAAGG - Intronic
1196193304 X:112815801-112815823 CAGAGGTCAGAGAAGAAGTAGGG + Exonic
1196996645 X:121390709-121390731 CTGGGTCCAGAGATGAAGAATGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197818994 X:130527721-130527743 CAGGTTTCAGAGAAAAAGCAAGG - Intergenic
1199149991 X:144420337-144420359 CAAGAACCAGAGAAGCAGGAAGG - Intergenic
1199470681 X:148192280-148192302 CAAGGTTCAGAGAAGAAAGGGGG - Intergenic
1200054067 X:153449562-153449584 CAGGGTCCAGAGCCCAAGGCCGG + Intronic
1200782535 Y:7229621-7229643 GAGGTTGCAGAGAAAAAGGAAGG - Intergenic
1200799924 Y:7377227-7377249 GATGGTCCAGAGAAAAAGCAAGG - Intergenic
1201238189 Y:11931518-11931540 CAGGGTCCGTAGAAGAGGGAAGG + Intergenic
1201599602 Y:15713522-15713544 AGGGGTCCAGAGAGGCAGGAAGG - Intergenic