ID: 1195322335

View in Genome Browser
Species Human (GRCh38)
Location X:103729830-103729852
Sequence CACCTTCTGAGGTTCAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195322325_1195322335 27 Left 1195322325 X:103729780-103729802 CCGCCAGCTCTGCGGAGTTCTGA No data
Right 1195322335 X:103729830-103729852 CACCTTCTGAGGTTCAATCCTGG No data
1195322324_1195322335 28 Left 1195322324 X:103729779-103729801 CCCGCCAGCTCTGCGGAGTTCTG No data
Right 1195322335 X:103729830-103729852 CACCTTCTGAGGTTCAATCCTGG No data
1195322326_1195322335 24 Left 1195322326 X:103729783-103729805 CCAGCTCTGCGGAGTTCTGATTG No data
Right 1195322335 X:103729830-103729852 CACCTTCTGAGGTTCAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195322335 Original CRISPR CACCTTCTGAGGTTCAATCC TGG Intergenic
No off target data available for this crispr