ID: 1195324266

View in Genome Browser
Species Human (GRCh38)
Location X:103745370-103745392
Sequence CAGTTTATCCAAAGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195324266_1195324272 13 Left 1195324266 X:103745370-103745392 CCTGAGCCCCTTTGGATAAACTG No data
Right 1195324272 X:103745406-103745428 GAGAACAAAGTATGTAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195324266 Original CRISPR CAGTTTATCCAAAGGGGCTC AGG (reversed) Intergenic
No off target data available for this crispr