ID: 1195324496

View in Genome Browser
Species Human (GRCh38)
Location X:103747304-103747326
Sequence CTTTACTAACAACTGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195324489_1195324496 19 Left 1195324489 X:103747262-103747284 CCAGTATTGAAATCATCCCAGGC No data
Right 1195324496 X:103747304-103747326 CTTTACTAACAACTGGAGTGAGG No data
1195324491_1195324496 2 Left 1195324491 X:103747279-103747301 CCAGGCAAAGCAGCCAGCCTCCT No data
Right 1195324496 X:103747304-103747326 CTTTACTAACAACTGGAGTGAGG No data
1195324490_1195324496 3 Left 1195324490 X:103747278-103747300 CCCAGGCAAAGCAGCCAGCCTCC No data
Right 1195324496 X:103747304-103747326 CTTTACTAACAACTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195324496 Original CRISPR CTTTACTAACAACTGGAGTG AGG Intergenic
No off target data available for this crispr