ID: 1195327611

View in Genome Browser
Species Human (GRCh38)
Location X:103770660-103770682
Sequence GAGGATCACATGGGATCCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195327597_1195327611 30 Left 1195327597 X:103770607-103770629 CCAAGCGTGGTGGCTTGTGCCTG 0: 6
1: 198
2: 3869
3: 31956
4: 116053
Right 1195327611 X:103770660-103770682 GAGGATCACATGGGATCCGTAGG No data
1195327600_1195327611 11 Left 1195327600 X:103770626-103770648 CCTGTAGTCTCAGCCACTTGGGA 0: 47
1: 3345
2: 54290
3: 172474
4: 261643
Right 1195327611 X:103770660-103770682 GAGGATCACATGGGATCCGTAGG No data
1195327607_1195327611 -2 Left 1195327607 X:103770639-103770661 CCACTTGGGAGGCTGGGGTGGGA 0: 6
1: 332
2: 866
3: 3226
4: 5873
Right 1195327611 X:103770660-103770682 GAGGATCACATGGGATCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195327611 Original CRISPR GAGGATCACATGGGATCCGT AGG Intergenic
No off target data available for this crispr