ID: 1195328875

View in Genome Browser
Species Human (GRCh38)
Location X:103780306-103780328
Sequence CCCACGAATGGGAAGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195328875_1195328881 1 Left 1195328875 X:103780306-103780328 CCTTTCATCTTCCCATTCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1195328881 X:103780330-103780352 AAGGTGGAGACAATGTGCCAAGG 0: 1
1: 0
2: 1
3: 15
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195328875 Original CRISPR CCCACGAATGGGAAGATGAA AGG (reversed) Intronic
901164830 1:7211944-7211966 GCCACATATGGAAAGATGAACGG - Intronic
901530134 1:9847693-9847715 CCCAAAAATGGGATTATGAAGGG + Intergenic
903821206 1:26103816-26103838 CCCAAGCTTGGGAAGAAGAAGGG + Intergenic
904070757 1:27795093-27795115 CCCACGACAGGGAAGTTGAAAGG - Intronic
909889529 1:80986564-80986586 CCCACTGATAGAAAGATGAATGG + Intergenic
910837434 1:91529865-91529887 CCCCTGTATGGGGAGATGAAAGG - Intergenic
912729577 1:112090401-112090423 CCCATACATGGGAAGAAGAAAGG - Intergenic
913318061 1:117568869-117568891 CCCTTGAATGTGAAGGTGAAAGG - Intergenic
916251488 1:162742735-162742757 CCCAAGACTGGGAAGAAAAAGGG + Intronic
920251536 1:204625342-204625364 CCAATGTATGGTAAGATGAAAGG - Intronic
920434455 1:205939068-205939090 CCCAGGAATAGGATGCTGAAGGG + Intronic
921792627 1:219307919-219307941 CCCAAGACTGGGAAGAAAAAAGG - Intergenic
1066170540 10:32839098-32839120 GCTACAAATGGTAAGATGAATGG + Intronic
1066459984 10:35604767-35604789 CCCACAAATGGCAAGTGGAATGG + Intergenic
1074046502 10:109844370-109844392 TCCACAAAGGGGAAGAGGAAGGG + Intergenic
1074990347 10:118700415-118700437 CTCAAGAATGGGAAGAGGAGAGG + Intronic
1075191626 10:120314965-120314987 CCCACGAGCTGGAAGAGGAAAGG - Intergenic
1075640584 10:124061481-124061503 CCCAAGACTGGGAAGAATAAGGG - Intronic
1077885682 11:6385964-6385986 CCCAGGAATGTGAAGATAAAGGG - Intergenic
1079316270 11:19410256-19410278 CATATGAAAGGGAAGATGAAAGG - Intronic
1079406678 11:20153763-20153785 TCCACGAATGGATGGATGAATGG - Intergenic
1081353573 11:42085911-42085933 CCCGCGAAGGGGAACATGAAGGG - Intergenic
1086345479 11:85891484-85891506 CCCAGGAATGAGAAGGTGAGGGG + Intronic
1086681422 11:89677982-89678004 CACACAAATGGGAAGTTGCAGGG - Intergenic
1090207048 11:124891230-124891252 CCCAGGAATGGGAATGTGATGGG - Intronic
1090337186 11:125978731-125978753 GCCAAGAAAGGGAAAATGAATGG - Intronic
1091289158 11:134427667-134427689 CCCACGAAAGGGAAGGTGCCTGG - Intergenic
1097309351 12:58101713-58101735 CCCAAGAGTGTGAAGAGGAATGG + Intergenic
1097893990 12:64806074-64806096 CCCACCAATGGGAAGACCAGTGG + Intronic
1100776353 12:97979256-97979278 ACCAGGAATGTGGAGATGAAGGG - Intergenic
1104277842 12:127346360-127346382 CCCATGGATGGACAGATGAATGG + Intergenic
1105428587 13:20316881-20316903 CCCCGGAATGGAAATATGAAAGG - Intergenic
1109808193 13:67471276-67471298 CCCAGGGATGTGAAGATGCAGGG + Intergenic
1115188636 14:30721944-30721966 TCCTAGAAAGGGAAGATGAAAGG + Intronic
1116254812 14:42538550-42538572 CCCACAAGTCGGGAGATGAAAGG - Intergenic
1128483808 15:68065255-68065277 ACCATGAGTGGGAAGGTGAAAGG - Intronic
1128620176 15:69142287-69142309 CACACAAATGGGAATATGGATGG - Intergenic
1129411876 15:75354779-75354801 CCCAAGAAGGGGAGGAGGAAGGG + Exonic
1135008417 16:18849752-18849774 CCAAGAAATGGGAAGCTGAAAGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144386816 17:14755759-14755781 CCCATGAATGGGGACATGAATGG - Intergenic
1146696440 17:34912138-34912160 CACAGGGTTGGGAAGATGAAGGG - Intergenic
1147050769 17:37793028-37793050 CCCAGGAAGAGGAAAATGAACGG - Intergenic
1148186827 17:45650482-45650504 GCTAAGAAAGGGAAGATGAAAGG - Intergenic
1149641650 17:58206621-58206643 CCCAAGAATGGGAATAAGAATGG - Intronic
1150671315 17:67200838-67200860 ACAACAAATGGGAAGATGATTGG - Intronic
1151010628 17:70490896-70490918 CCCACGAATTGGGATATCAAAGG + Intergenic
1155088113 18:22477230-22477252 TCCAGGGATGTGAAGATGAAGGG - Intergenic
1155604948 18:27594343-27594365 GCCACGAAAGGGAAGGTGCAAGG - Intergenic
1155718151 18:28972359-28972381 TGCAGGAATGGGAAGATAAAAGG + Intergenic
1157373133 18:47136793-47136815 CCAAAGAATGGGTGGATGAAAGG + Intronic
1158566719 18:58560348-58560370 CCCAAGAATGGGAAGAAAAGAGG - Intronic
1165588568 19:36944678-36944700 TCCACAACTGGGAAGATGATGGG - Intronic
1168189522 19:54727554-54727576 CCCATGAATGGGATGAGAAAGGG + Intronic
925563930 2:5229307-5229329 CCAAACAATGGGAAGATGCAAGG - Intergenic
927314586 2:21667152-21667174 CCAACGAATGAGATGATCAAAGG - Intergenic
928934900 2:36665635-36665657 CCAGCCAATGGGAAGATGGAGGG - Intergenic
929576247 2:43054682-43054704 AACATGAATGGGAATATGAACGG + Intergenic
929631812 2:43470603-43470625 CTCACGAATGAGAAAATGACAGG + Intronic
930413562 2:51058920-51058942 CCTAAGAATAAGAAGATGAATGG + Intergenic
931629683 2:64287455-64287477 CCCAAGACTGGGAAGGTGATGGG - Intergenic
931845985 2:66204289-66204311 CTCACAAATGGGAAGTTGATAGG - Intergenic
934605959 2:95695296-95695318 CCCAAGGATGAGATGATGAAGGG - Intergenic
935137512 2:100321261-100321283 CCTAAGGATGGGAAGGTGAAAGG - Intronic
935720477 2:105974744-105974766 CACAAGAATGGGAAAATGATTGG - Intergenic
937544921 2:123004980-123005002 TCCAGGAATGTGAAGATGCAGGG - Intergenic
937936294 2:127248241-127248263 CCCACGAAGGGGAAGATCTAGGG - Intergenic
940008418 2:149030808-149030830 TCCACGTATGGGAAACTGAATGG - Intergenic
941548646 2:166886536-166886558 CCCAGGAGAGTGAAGATGAATGG - Intergenic
942252953 2:174063352-174063374 CACAAAAATGGGAAGATAAAAGG + Intergenic
947432826 2:230045620-230045642 GGCAGGAATGGGAAGATAAAAGG + Intronic
947780416 2:232755644-232755666 CACATTAATGGGAAGACGAAGGG - Intronic
948317771 2:237042287-237042309 CCCTGGAGTGGGAGGATGAAAGG - Intergenic
1172972347 20:38882835-38882857 CCCAAGAATGGGAAGAAAGAAGG + Intronic
1173222335 20:41140309-41140331 CCCACGAATGGGTAGAAGCAGGG - Intronic
1173756575 20:45521885-45521907 CCCAGGATTGGGAGGATGAGAGG - Intergenic
1178020231 21:28399687-28399709 CCCAAGACTGGGAAGATAAAAGG - Intergenic
1179987623 21:44930341-44930363 CCCAGGGATGAGCAGATGAAGGG + Intronic
949982986 3:9514664-9514686 CCCACGGTTGGGAGGAGGAAGGG - Intronic
953787894 3:45924302-45924324 CCCAGGCACGGGAAGATGAAAGG - Intronic
953931654 3:47008792-47008814 CCTCCCCATGGGAAGATGAAGGG - Intronic
956284821 3:67597469-67597491 ACCAGGAATGCAAAGATGAATGG + Intronic
959623339 3:108422508-108422530 CCCACGATGGGGCAGATGGAAGG - Intronic
960584796 3:119310802-119310824 CACACGCCTGGGAAGATTAAAGG + Intronic
961579793 3:127871355-127871377 CCCATGGATCGGAAGAGGAAAGG - Intergenic
964394867 3:156234618-156234640 GTGAAGAATGGGAAGATGAAAGG + Intronic
965795161 3:172432052-172432074 CCCAAGACTGGGAAGACAAAGGG + Intergenic
967315920 3:188152495-188152517 GCCAGGTATGGAAAGATGAAGGG + Intergenic
967326110 3:188241447-188241469 CCCCCAAAGGGAAAGATGAAAGG - Intronic
968715628 4:2157108-2157130 CCCATGCATGGGGAGAGGAAGGG + Intronic
969852181 4:9966924-9966946 CACAAGAATGGAAAGATCAAAGG - Intronic
973295191 4:48511213-48511235 CTCAGGAATAGGGAGATGAATGG - Intronic
974999775 4:69208338-69208360 CCCACAAAAGGTAAGATAAAGGG - Exonic
977228955 4:94428780-94428802 CCCCAGTATGGGGAGATGAAGGG + Intergenic
983691814 4:170480062-170480084 CCCATAAATGAGAAAATGAAGGG - Intergenic
986806415 5:11312333-11312355 CCCAAGACTGGGAAGAAAAAGGG + Intronic
992702028 5:79350500-79350522 CCCACGATGGAGAAAATGAATGG + Intergenic
993561442 5:89416047-89416069 ACCAGGAATGAGAAGATGAGGGG - Intergenic
995039035 5:107567610-107567632 CCCAAGAAAGGGAAGACAAAAGG + Intronic
996460055 5:123731740-123731762 CCCAAGACTGGGAAGAAAAAAGG - Intergenic
998100000 5:139424799-139424821 CCCAAGAATGGGCAGAGGGAGGG + Intronic
999234475 5:150082201-150082223 CCCATCACTGGGAAGAGGAAGGG - Intronic
1001083866 5:168686333-168686355 CCTACCCATGGAAAGATGAATGG + Intronic
1001215366 5:169851089-169851111 ACCACGGATGGAAGGATGAATGG - Intronic
1012099854 6:95018860-95018882 CTCAGGAATGGAAATATGAAGGG - Intergenic
1013203652 6:107926832-107926854 CCAAGGAATGAGAAGAGGAAAGG + Intronic
1013620207 6:111880389-111880411 CTCAGGAATGGGAAGATTGATGG + Intergenic
1014724122 6:124955342-124955364 TCCAGGAATGTGAAGATGCAGGG - Intergenic
1016782942 6:147979814-147979836 CCCAAGACTGGGAAGAAAAAGGG - Intergenic
1017432665 6:154386199-154386221 CCCAGGGATGGACAGATGAAGGG - Intronic
1017885534 6:158596659-158596681 CCCAAGACTGGGAAGAAAAAGGG + Intronic
1017911595 6:158797669-158797691 CCCACAAATGGGAGTATGATAGG + Intronic
1020761923 7:12278372-12278394 TCCAGGCATGGGAAGATGCAGGG + Intergenic
1021507550 7:21402211-21402233 CCCAAGACTGGGAAGAAAAAAGG - Intergenic
1023680717 7:42684645-42684667 CACACAAATTTGAAGATGAAAGG + Intergenic
1024314687 7:48004543-48004565 CCCATGAATGGGCAGCTGAGAGG + Intronic
1026283627 7:68944073-68944095 CCCATGAAAGGGAAGAGGGAAGG - Intergenic
1028677410 7:93481521-93481543 CCCAAGAAAGGGAAGATGCTGGG + Intronic
1028952579 7:96653529-96653551 CCCAGCAATGGGAAGAGGAATGG + Intronic
1030579617 7:111337508-111337530 CCAATGAATGGGCAGATGGATGG + Intronic
1031150860 7:118052573-118052595 CCCCTGCCTGGGAAGATGAAAGG + Intergenic
1031257912 7:119480711-119480733 CCCACGAATGGTAGGAGGAAAGG - Intergenic
1031998562 7:128249077-128249099 CCCAAGAAGGGGAGGAAGAATGG - Intronic
1034103967 7:148474900-148474922 GCCATGGAAGGGAAGATGAAGGG - Intergenic
1035944524 8:3946664-3946686 ACCATGAATGAGAAGATGCAGGG - Intronic
1036300394 8:7565898-7565920 CCCACAGACGGGAAGCTGAAAGG + Intergenic
1036324788 8:7770418-7770440 CCCACAGACGGGAAGCTGAAAGG - Intergenic
1043341571 8:79246394-79246416 CCCAAGATTGGGAGAATGAATGG - Intergenic
1044019893 8:87093196-87093218 CCCACGAATGGAAAGACTCAGGG - Intronic
1045469964 8:102503696-102503718 CCCACAACTGGGTAGCTGAAGGG - Intergenic
1048934835 8:139346170-139346192 CCCAGGAAAGGGGAGATGAATGG + Intergenic
1050420417 9:5458507-5458529 CCCAGGAATGGAAAGACCAAGGG - Intronic
1057518443 9:95740822-95740844 ACCAAGATTGGGAAGAGGAAAGG - Intergenic
1058241524 9:102568583-102568605 CCCATGACTGGTAAGAGGAATGG + Intergenic
1058947491 9:109872095-109872117 CACAGGAATGGGCAGATTAATGG - Intronic
1060021208 9:120132975-120132997 CCCAAGACTGGGAAGAAAAAGGG + Intergenic
1060324859 9:122604326-122604348 CCCAAGAAGGGGAATAGGAATGG + Intergenic
1060670794 9:125467621-125467643 CCCCCAAATGGGAAGGGGAAGGG + Intronic
1187249208 X:17581738-17581760 ACCACGAAGGGGAAGGTGAAAGG - Intronic
1189733849 X:44049369-44049391 CCCAGGACTGGGAAGAGGAGTGG + Intergenic
1195328875 X:103780306-103780328 CCCACGAATGGGAAGATGAAAGG - Intronic
1196891546 X:120295412-120295434 CCCAAGAATGAGAGAATGAATGG + Intronic