ID: 1195331077

View in Genome Browser
Species Human (GRCh38)
Location X:103801189-103801211
Sequence GGGGTGCTGGAACACTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195331077_1195331087 22 Left 1195331077 X:103801189-103801211 CCTCCACAGTGTTCCAGCACCCC No data
Right 1195331087 X:103801234-103801256 CCTTGTTTACCATTTATAGTAGG No data
1195331077_1195331088 23 Left 1195331077 X:103801189-103801211 CCTCCACAGTGTTCCAGCACCCC No data
Right 1195331088 X:103801235-103801257 CTTGTTTACCATTTATAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195331077 Original CRISPR GGGGTGCTGGAACACTGTGG AGG (reversed) Intergenic
No off target data available for this crispr