ID: 1195332850

View in Genome Browser
Species Human (GRCh38)
Location X:103819923-103819945
Sequence TGCCATAACCTTGGGGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195332850_1195332857 -9 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332857 X:103819937-103819959 GTTATGGCATTATAAGGAGATGG No data
1195332850_1195332862 12 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332862 X:103819958-103819980 GGGGCCTTTGGAAGGTGATTAGG 0: 42
1: 416
2: 1258
3: 2350
4: 3459
1195332850_1195332864 20 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332864 X:103819966-103819988 TGGAAGGTGATTAGGTCACAAGG No data
1195332850_1195332860 0 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332860 X:103819946-103819968 TTATAAGGAGATGGGGCCTTTGG No data
1195332850_1195332861 4 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332861 X:103819950-103819972 AAGGAGATGGGGCCTTTGGAAGG No data
1195332850_1195332865 21 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332865 X:103819967-103819989 GGAAGGTGATTAGGTCACAAGGG No data
1195332850_1195332858 -8 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332858 X:103819938-103819960 TTATGGCATTATAAGGAGATGGG No data
1195332850_1195332859 -7 Left 1195332850 X:103819923-103819945 CCTAACCCCCCAAGGTTATGGCA No data
Right 1195332859 X:103819939-103819961 TATGGCATTATAAGGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195332850 Original CRISPR TGCCATAACCTTGGGGGGTT AGG (reversed) Intergenic
No off target data available for this crispr