ID: 1195333430

View in Genome Browser
Species Human (GRCh38)
Location X:103826035-103826057
Sequence GGAAAATGGCTGAGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195333430 Original CRISPR GGAAAATGGCTGAGTGCCAT GGG Intronic
912635381 1:111287154-111287176 GGCAAATGCCTGAGTGCAGTAGG + Intergenic
916839465 1:168584838-168584860 GGAAAATGGTTGAGGGCAGTGGG + Intergenic
917261137 1:173171600-173171622 GGAAAATTGCTGTGTACCTTGGG + Intergenic
918526687 1:185472489-185472511 GTGAAATGGCTCAGTGCCACAGG + Intergenic
919557537 1:199077802-199077824 GTAATATGCCTGATTGCCATTGG - Intergenic
919793286 1:201305986-201306008 GGGAGATGGCTGAGGGCCAGTGG + Intronic
921268362 1:213444981-213445003 GGATGATGGCTAAGTGGCATGGG - Intergenic
922283837 1:224151160-224151182 GGATGATGGCTGATTGCCAAAGG - Intronic
1063550359 10:7026845-7026867 TGAAAATGACTGTGTTCCATAGG - Intergenic
1065842616 10:29715734-29715756 CTAAAATTCCTGAGTGCCATGGG + Intronic
1070807160 10:79277325-79277347 GGTAAGTGGGTGGGTGCCATGGG + Exonic
1071569958 10:86691398-86691420 GGAAAAGGACTGGGGGCCATGGG - Intronic
1071835899 10:89416354-89416376 GGAAAAGGGCTCAGCCCCATTGG + Intronic
1071915053 10:90285268-90285290 GGAAAATAACTCAGTGTCATAGG + Intergenic
1075153559 10:119956013-119956035 GGGACTTGACTGAGTGCCATTGG + Intergenic
1075592629 10:123703600-123703622 TGGGAATGGCTCAGTGCCATGGG - Intergenic
1084157572 11:67322741-67322763 GGAGGGAGGCTGAGTGCCATGGG + Intronic
1085807299 11:79648138-79648160 AAAAATTGGCTGAGTACCATGGG + Intergenic
1089748891 11:120636329-120636351 GGATTATGACAGAGTGCCATGGG - Intronic
1092042305 12:5395594-5395616 GCAGGATGGCTGGGTGCCATTGG - Intergenic
1094611939 12:32002971-32002993 GGAAAAAGGCTGACATCCATAGG - Intergenic
1097481253 12:60128564-60128586 GGAAAAAGGATGAATGCCACAGG - Intergenic
1102090337 12:110182022-110182044 GCCAAATGACTGACTGCCATGGG - Intronic
1103682156 12:122702704-122702726 GGAACATGGCTTCGTGCCACTGG + Exonic
1103981672 12:124740889-124740911 GGAGAAAGCCTGAGTTCCATGGG + Intergenic
1104359413 12:128117900-128117922 GGATGATGGGTGAGTGCGATCGG - Intergenic
1105503607 13:20992065-20992087 GTAAAATGGATGAGGGCCACAGG + Intronic
1105931339 13:25055682-25055704 GGAAAACAGCTCAGTGCCAGTGG - Intergenic
1106780014 13:33049786-33049808 GGAAAATGGCTGATAGCAGTTGG - Intronic
1110435858 13:75477802-75477824 GGAAAAGGGCTTAATCCCATTGG - Intronic
1112337372 13:98526274-98526296 GGAAAATGCCTGAGTCATATTGG - Intronic
1114415722 14:22542562-22542584 GGAAATTAGCTAAGTGCCCTTGG + Intergenic
1114909972 14:27179670-27179692 GGAACATGGTATAGTGCCATTGG - Intergenic
1116273898 14:42805964-42805986 TGAAAATGGCTGAATTCCAAGGG - Intergenic
1120208610 14:81612490-81612512 GGAAAATGGCAGAGTTCAACTGG + Intergenic
1122617942 14:103033723-103033745 AGAGGATGGCTGAGTGACATGGG + Intronic
1123930733 15:25170568-25170590 GGACACTGGCCGAGGGCCATTGG - Intergenic
1124886866 15:33695319-33695341 TGAAAATTGCTGATTGGCATTGG - Intronic
1125827599 15:42689537-42689559 GGAAACTGACAGAGAGCCATGGG + Exonic
1128269797 15:66299108-66299130 GGAAAATGCCTGGGGCCCATGGG + Intronic
1128640940 15:69336506-69336528 GTTAAATGGCTGTGTGCCACAGG + Intronic
1133248836 16:4466735-4466757 GGAAGATGGCTGAGCTCCATGGG - Intronic
1135035812 16:19075898-19075920 GGAAAATGGCAGATAGCAATTGG + Intronic
1136160026 16:28413944-28413966 GCAAGATGGCCGAGTGCCAGAGG + Intergenic
1136203062 16:28701348-28701370 GCAAGATGGCCGAGTGCCAGAGG - Intronic
1137026315 16:35479141-35479163 GGAAGATGGCTTAGAGCCCTGGG - Intergenic
1140474182 16:75230369-75230391 GGAAAATGGCTGAAGGGCACTGG + Intronic
1141705806 16:85663847-85663869 GGGAGATGGATGAGTGACATGGG - Intronic
1142487905 17:258722-258744 CCAAAATGGCTGAGTACCAATGG - Intronic
1143818576 17:9540930-9540952 GGTGAATGGCTGAGTGGCATGGG - Intronic
1146568468 17:33933457-33933479 GAAAAATGGCTGAATCTCATTGG - Intronic
1146816123 17:35943847-35943869 GGAAAATGGCCGGGTGGGATAGG + Intergenic
1150785758 17:68161713-68161735 GGAAAATGGCTGGGTGGGACAGG + Intergenic
1152993317 18:383057-383079 GGAAAATGACAGAGTCCCGTTGG - Intronic
1153337064 18:3935851-3935873 GGAAAATGGCAGAGTGGAAAAGG - Intronic
1156422734 18:36972817-36972839 GGAATATACCTGAGGGCCATTGG + Intronic
1156642498 18:39119466-39119488 GGAAAGAGGCTGAGTGCTGTTGG + Intergenic
1159912412 18:74158908-74158930 TGAAAATGGTTGAGGGCCATAGG + Exonic
1160261477 18:77298290-77298312 AGAAAATGGGTGAGGTCCATGGG + Intergenic
1162362344 19:10227645-10227667 GGCAAATTGCTCAGTGCCCTTGG - Intronic
1163574672 19:18103701-18103723 GGAAAATGGCCCAGTGACATAGG - Intronic
1164393998 19:27848274-27848296 GAGAAATGCCAGAGTGCCATTGG + Intergenic
1164617990 19:29678031-29678053 AGAAATTAGCTGGGTGCCATTGG - Intergenic
1164630655 19:29759622-29759644 GGCAGGTGGCAGAGTGCCATGGG - Intergenic
925546209 2:5019648-5019670 GGAAAATGGGTGAATGCCACTGG + Intergenic
925815089 2:7739562-7739584 GAAAGATGGCTGAGAGACATGGG + Intergenic
929933145 2:46274056-46274078 GGAAAATGGATGAGGGCCTGGGG + Intergenic
930229217 2:48826839-48826861 GGAAAAGGGCTGAATGCAAGGGG + Intergenic
930525742 2:52527121-52527143 GGAAAATGGATCAGTGCTTTGGG + Intergenic
932071586 2:68626124-68626146 GAACAAGGGCAGAGTGCCATAGG + Intronic
933942879 2:87259844-87259866 TGAAGATGGCTGAGTGCTATGGG - Intergenic
935788346 2:106569168-106569190 GAAAAATGGCTACTTGCCATTGG + Intergenic
936337336 2:111601718-111601740 TGAAGATGGCTGAGTGCTATGGG + Intergenic
939386888 2:141512278-141512300 GGAAGATTGCTGATTGCCTTAGG + Intronic
939797526 2:146664960-146664982 AGAAAATGGCTGAGAGACCTTGG - Intergenic
940282386 2:152001234-152001256 GGCCAAAGGCTGAGTGCCAAGGG + Intronic
940383817 2:153047103-153047125 GGAAAATGGCAAAGTCCCAGAGG - Intergenic
945746927 2:213729566-213729588 GGCAAAGGACTGAGGGCCATTGG - Intronic
1168764922 20:375355-375377 CAACAATGGCTGAGTGCCAGAGG - Intronic
1170132103 20:13031765-13031787 GGAAAAAGACTAAGTCCCATGGG + Intronic
1170208244 20:13822664-13822686 GGGAAATGGTTGCGAGCCATTGG + Intergenic
1171324161 20:24276249-24276271 GGAAAATAGGTGAGTGCCATGGG + Intergenic
1173663812 20:44751736-44751758 GGGAAGTGGCTGAGTGCCACGGG - Exonic
1175773093 20:61635899-61635921 GGAAAATGACTTAGTGGCAGTGG + Intronic
1181261694 22:21602676-21602698 ACAAAATGGCTTTGTGCCATGGG + Intronic
951088082 3:18538478-18538500 GCAAAATGGCTCAGTCCCATTGG + Intergenic
953083079 3:39639459-39639481 GGAAAAGGGCTGAGTCACAGTGG + Intergenic
954920981 3:54190656-54190678 GCAAAATGGCTCACTGCCAATGG - Intronic
955771459 3:62388985-62389007 GGAAAATATCTGATTTCCATTGG + Intergenic
956240222 3:67121762-67121784 GGAAAAATGGTGAGTGCTATGGG + Intergenic
960267164 3:115633337-115633359 GAAAAAGGGCTGGGTGACATAGG + Intronic
962437051 3:135376505-135376527 GGAAAATGGGAAAGTGGCATGGG + Intergenic
965369577 3:167844186-167844208 AGAAAATGGCTGAATTACATAGG + Intergenic
968324157 3:197797707-197797729 AAAAAATAGCTGGGTGCCATTGG + Intronic
969642263 4:8405941-8405963 GGATAATGGGTGAGTGACAGAGG - Exonic
970909587 4:21259147-21259169 GGAAAAGTGGTGAATGCCATGGG - Intronic
976279945 4:83317294-83317316 TGGTAATGGCTGAGTGACATGGG - Intronic
976857456 4:89622025-89622047 AGCAAATGTCTGATTGCCATGGG + Intergenic
976907976 4:90263560-90263582 AGAAAATGGCTGTGTGACTTCGG - Intronic
977120268 4:93091042-93091064 TGAACATGGCTGAGTTCCAATGG - Intronic
977143729 4:93409089-93409111 GGAAAATGACTTAATACCATTGG + Intronic
977611173 4:99033331-99033353 GGAAAAGGTCTGAGTGCACTGGG + Intronic
977855258 4:101882561-101882583 GGAAAGTGGCTGCATGGCATAGG + Intronic
982289254 4:153763545-153763567 GGAAAATTGCTGAGTGGTCTAGG - Intergenic
983551075 4:169018033-169018055 TGAAAATGGCTGAGCCCCATAGG + Intergenic
986076129 5:4340029-4340051 GGCAAAAAGCTGAGTGCAATGGG - Intergenic
986227539 5:5829460-5829482 AGACTGTGGCTGAGTGCCATGGG - Intergenic
989818471 5:45765279-45765301 GAAAAATGGCTGTGTGATATCGG - Intergenic
991607993 5:68422454-68422476 GGAAGAAGGCTGAGTGACAAGGG + Intergenic
992629432 5:78666280-78666302 GTAAAGTGCCTGAGTGCCTTGGG + Intronic
996557182 5:124790569-124790591 GGAGAATGGCTGATTGTGATGGG - Intergenic
999436613 5:151568227-151568249 GGAAAATCTCTGAGGGCAATGGG - Exonic
1000699115 5:164426169-164426191 GGAAAATGGGTGAGTGCAGAGGG + Intergenic
1001546910 5:172575914-172575936 GGAAGATGGCTGTGGGCCCTGGG + Intergenic
1001654027 5:173335766-173335788 GGAGAATGGGTGAGGGACATGGG + Intergenic
1002023880 5:176383774-176383796 GGAAATGGGCAGAGAGCCATCGG + Intronic
1004985160 6:21073420-21073442 GCAAAATGGCAGAGTGGCTTTGG - Intronic
1006746043 6:36342723-36342745 GGAAAATGACTAAGTGGCAAGGG + Intergenic
1008755286 6:54788033-54788055 GGAGAATGGCTGGTTGCCTTAGG - Intergenic
1013660112 6:112287085-112287107 GGAAGATGGATATGTGCCATTGG + Intergenic
1013883789 6:114936727-114936749 GTAAAATGACTAATTGCCATTGG - Intergenic
1014264627 6:119262297-119262319 GGCAAATGGCTGATAACCATGGG + Intronic
1014709312 6:124787737-124787759 GAAAAATGGCATAGTTCCATTGG + Intronic
1015286018 6:131487357-131487379 GGAAAATTGATCAGTGCCAGAGG - Intergenic
1018423812 6:163662759-163662781 GGGAAATGGCTCAGTGGCCTGGG - Intergenic
1018559098 6:165082669-165082691 GGAAACTGGCTGATTGACAACGG + Intergenic
1021055394 7:16041168-16041190 GGAAAATGGCTGGGAGGCCTAGG - Intergenic
1024175612 7:46837539-46837561 GGGAGATGGCTGGTTGCCATGGG + Intergenic
1024588950 7:50864452-50864474 GGAGAAGGGCTCAGTCCCATAGG - Intergenic
1026322499 7:69279888-69279910 GCAAAATGGCTGAGTTTCACTGG - Intergenic
1027488699 7:78794491-78794513 GAAAAATGCCTGTTTGCCATAGG + Intronic
1028064441 7:86364792-86364814 GGAAAATGCTTGAATGCCAAAGG + Intergenic
1029857912 7:103537478-103537500 GGAAAGTGGCTGAGTGGAGTTGG - Intronic
1030533433 7:110737308-110737330 GGAAACAGACTCAGTGCCATTGG + Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031630055 7:124033733-124033755 GACGAATGGCTGAGTGCCACGGG + Intergenic
1032931134 7:136672817-136672839 GGAAAATGGTTGTGTTCCTTTGG + Intergenic
1034257235 7:149731326-149731348 GGAAAATGGCAGAGTGGGCTGGG + Intronic
1034281275 7:149856099-149856121 AGAGAATGGCTGAGGGCCAGGGG - Intronic
1034542532 7:151767917-151767939 GGAAAATGGCTGAGAGAAAAAGG - Intronic
1038971980 8:32646704-32646726 GGAAAACGGGTGGGGGCCATGGG + Intronic
1041799861 8:61787182-61787204 GGAAAATGGATGAGAGCAAGTGG + Intergenic
1041828467 8:62125128-62125150 GGAAAATGGATGAGAGCAAGTGG + Intergenic
1050704111 9:8376449-8376471 GAAAAATGGCTGAGTGATAATGG + Intronic
1051088619 9:13380611-13380633 GGAGAAGGGCTGATTGGCATGGG + Intergenic
1052647704 9:31257579-31257601 GGAAAATGGTAAAATGCCATAGG - Intergenic
1053434306 9:38065424-38065446 GGGAAATGGCTGAGGGTCCTGGG - Intronic
1054878495 9:70121205-70121227 GGGAAATGGCTGACTACCAGGGG + Intronic
1056961220 9:91125714-91125736 GGAAAATAAAAGAGTGCCATGGG - Intergenic
1057124265 9:92603763-92603785 GGACCATGGCTGAGTGACACTGG - Intronic
1058299207 9:103348667-103348689 TGAAAATGACTGACTGCCAATGG + Intergenic
1058966911 9:110047559-110047581 GGAAAATAGCAGACTGCCCTAGG + Intronic
1059829178 9:118073630-118073652 GGAAAAAGACTGAATGCCATGGG + Intergenic
1061399217 9:130359362-130359384 GGAAAATGCCTCAGTGACCTTGG + Intronic
1185694978 X:2187381-2187403 GGAAAATGGGTCACTGCCTTGGG + Intergenic
1185717407 X:2353930-2353952 GGAGAATGACTGAGTACCAGTGG + Intronic
1187553717 X:20331398-20331420 GGATAATGGCTGAGTGGTACAGG - Intergenic
1193616132 X:83689782-83689804 GGCAATTGGCAGTGTGCCATAGG - Intergenic
1193796949 X:85888607-85888629 GCAAAATGGCAGAGTCCCCTGGG + Intronic
1195333430 X:103826035-103826057 GGAAAATGGCTGAGTGCCATGGG + Intronic
1197236761 X:124074863-124074885 GGAAAATGTCTGTATGCGATTGG + Intronic
1198673762 X:139109910-139109932 TGAAAATAGGTGTGTGCCATTGG - Intronic
1199840256 X:151639256-151639278 GGAAAAGGGCAGAATGCCAGGGG - Intronic
1200144242 X:153918278-153918300 GGAAAATGGCTGCTTGACACCGG + Intronic