ID: 1195341638

View in Genome Browser
Species Human (GRCh38)
Location X:103912336-103912358
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195341635_1195341638 -8 Left 1195341635 X:103912321-103912343 CCTTTTTCACTCTCATGCTCTCT No data
Right 1195341638 X:103912336-103912358 TGCTCTCTCGCGTGTATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195341638 Original CRISPR TGCTCTCTCGCGTGTATGGT GGG Intergenic
No off target data available for this crispr