ID: 1195349183

View in Genome Browser
Species Human (GRCh38)
Location X:103980742-103980764
Sequence AGGCAGATCCATAGGACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195349176_1195349183 20 Left 1195349176 X:103980699-103980721 CCCCCTGCTCCTCTTAAGTTTCG No data
Right 1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG No data
1195349178_1195349183 18 Left 1195349178 X:103980701-103980723 CCCTGCTCCTCTTAAGTTTCGCT No data
Right 1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG No data
1195349177_1195349183 19 Left 1195349177 X:103980700-103980722 CCCCTGCTCCTCTTAAGTTTCGC No data
Right 1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG No data
1195349175_1195349183 28 Left 1195349175 X:103980691-103980713 CCAAGGTTCCCCCTGCTCCTCTT No data
Right 1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG No data
1195349179_1195349183 17 Left 1195349179 X:103980702-103980724 CCTGCTCCTCTTAAGTTTCGCTG No data
Right 1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG No data
1195349180_1195349183 11 Left 1195349180 X:103980708-103980730 CCTCTTAAGTTTCGCTGAAAACT No data
Right 1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195349183 Original CRISPR AGGCAGATCCATAGGACATA AGG Intergenic
No off target data available for this crispr