ID: 1195349875

View in Genome Browser
Species Human (GRCh38)
Location X:103985863-103985885
Sequence TCATCTCGAGGATGGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195349875_1195349883 14 Left 1195349875 X:103985863-103985885 CCCACAGGCCATCCTCGAGATGA No data
Right 1195349883 X:103985900-103985922 CCGGGTCAAGCGAGCCTCCTTGG No data
1195349875_1195349880 -4 Left 1195349875 X:103985863-103985885 CCCACAGGCCATCCTCGAGATGA No data
Right 1195349880 X:103985882-103985904 ATGAACTGTAGAACAAGCCCGGG No data
1195349875_1195349879 -5 Left 1195349875 X:103985863-103985885 CCCACAGGCCATCCTCGAGATGA No data
Right 1195349879 X:103985881-103985903 GATGAACTGTAGAACAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195349875 Original CRISPR TCATCTCGAGGATGGCCTGT GGG (reversed) Intergenic