ID: 1195356551

View in Genome Browser
Species Human (GRCh38)
Location X:104044838-104044860
Sequence AGGCAGATCCATAGGACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195356547_1195356551 17 Left 1195356547 X:104044798-104044820 CCTTGTCCTCTTAAGTTTCACTG No data
Right 1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG No data
1195356542_1195356551 29 Left 1195356542 X:104044786-104044808 CCAAGATTCCCCCCTTGTCCTCT No data
Right 1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG No data
1195356548_1195356551 11 Left 1195356548 X:104044804-104044826 CCTCTTAAGTTTCACTGAAAACT No data
Right 1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG No data
1195356546_1195356551 18 Left 1195356546 X:104044797-104044819 CCCTTGTCCTCTTAAGTTTCACT No data
Right 1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG No data
1195356544_1195356551 20 Left 1195356544 X:104044795-104044817 CCCCCTTGTCCTCTTAAGTTTCA No data
Right 1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG No data
1195356545_1195356551 19 Left 1195356545 X:104044796-104044818 CCCCTTGTCCTCTTAAGTTTCAC No data
Right 1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG No data
1195356543_1195356551 21 Left 1195356543 X:104044794-104044816 CCCCCCTTGTCCTCTTAAGTTTC No data
Right 1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195356551 Original CRISPR AGGCAGATCCATAGGACATA AGG Intergenic
No off target data available for this crispr