ID: 1195357144 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:104049408-104049430 |
| Sequence | ACTTTTACCCGGCAGAGGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195357135_1195357144 | 3 | Left | 1195357135 | X:104049382-104049404 | CCCAGAATACAAGTGCCTTCCCC | No data | ||
| Right | 1195357144 | X:104049408-104049430 | ACTTTTACCCGGCAGAGGCAGGG | No data | ||||
| 1195357136_1195357144 | 2 | Left | 1195357136 | X:104049383-104049405 | CCAGAATACAAGTGCCTTCCCCA | No data | ||
| Right | 1195357144 | X:104049408-104049430 | ACTTTTACCCGGCAGAGGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195357144 | Original CRISPR | ACTTTTACCCGGCAGAGGCA GGG | Intergenic | ||
| No off target data available for this crispr | |||||