ID: 1195357144

View in Genome Browser
Species Human (GRCh38)
Location X:104049408-104049430
Sequence ACTTTTACCCGGCAGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195357135_1195357144 3 Left 1195357135 X:104049382-104049404 CCCAGAATACAAGTGCCTTCCCC No data
Right 1195357144 X:104049408-104049430 ACTTTTACCCGGCAGAGGCAGGG No data
1195357136_1195357144 2 Left 1195357136 X:104049383-104049405 CCAGAATACAAGTGCCTTCCCCA No data
Right 1195357144 X:104049408-104049430 ACTTTTACCCGGCAGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195357144 Original CRISPR ACTTTTACCCGGCAGAGGCA GGG Intergenic
No off target data available for this crispr