ID: 1195357568

View in Genome Browser
Species Human (GRCh38)
Location X:104052976-104052998
Sequence TCATCTCGAGGATGGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195357564_1195357568 -5 Left 1195357564 X:104052958-104052980 CCGGGCTTGTTCTACAGTTCATC No data
Right 1195357568 X:104052976-104052998 TCATCTCGAGGATGGCCTGTGGG No data
1195357563_1195357568 -4 Left 1195357563 X:104052957-104052979 CCCGGGCTTGTTCTACAGTTCAT No data
Right 1195357568 X:104052976-104052998 TCATCTCGAGGATGGCCTGTGGG No data
1195357560_1195357568 14 Left 1195357560 X:104052939-104052961 CCAAGGAGGCTCGCTTGACCCGG No data
Right 1195357568 X:104052976-104052998 TCATCTCGAGGATGGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195357568 Original CRISPR TCATCTCGAGGATGGCCTGT GGG Intergenic