ID: 1195358260

View in Genome Browser
Species Human (GRCh38)
Location X:104058097-104058119
Sequence AGGCAGATCCATAGGACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195358260_1195358265 18 Left 1195358260 X:104058097-104058119 CCTTATGTCCTATGGATCTGCCT No data
Right 1195358265 X:104058138-104058160 AGCGAAACTTAAGAGGAGCAGGG No data
1195358260_1195358264 17 Left 1195358260 X:104058097-104058119 CCTTATGTCCTATGGATCTGCCT No data
Right 1195358264 X:104058137-104058159 CAGCGAAACTTAAGAGGAGCAGG No data
1195358260_1195358263 11 Left 1195358260 X:104058097-104058119 CCTTATGTCCTATGGATCTGCCT No data
Right 1195358263 X:104058131-104058153 AGTTTTCAGCGAAACTTAAGAGG No data
1195358260_1195358266 19 Left 1195358260 X:104058097-104058119 CCTTATGTCCTATGGATCTGCCT No data
Right 1195358266 X:104058139-104058161 GCGAAACTTAAGAGGAGCAGGGG No data
1195358260_1195358267 20 Left 1195358260 X:104058097-104058119 CCTTATGTCCTATGGATCTGCCT No data
Right 1195358267 X:104058140-104058162 CGAAACTTAAGAGGAGCAGGGGG No data
1195358260_1195358268 28 Left 1195358260 X:104058097-104058119 CCTTATGTCCTATGGATCTGCCT No data
Right 1195358268 X:104058148-104058170 AAGAGGAGCAGGGGGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195358260 Original CRISPR AGGCAGATCCATAGGACATA AGG (reversed) Intergenic
No off target data available for this crispr