ID: 1195363618

View in Genome Browser
Species Human (GRCh38)
Location X:104107328-104107350
Sequence ACTGGCTATGAGGGTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195363618_1195363632 28 Left 1195363618 X:104107328-104107350 CCTCCTTTACCCTCATAGCCAGT 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1195363632 X:104107379-104107401 CCTTTAGCTGAGAACTGAGCAGG 0: 2
1: 1
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195363618 Original CRISPR ACTGGCTATGAGGGTAAAGG AGG (reversed) Intronic
900406078 1:2493601-2493623 GCTCCCTATGAGGGTGAAGGAGG + Intronic
900507078 1:3035058-3035080 ACTTGCTGTGAGGGTGGAGGTGG + Intergenic
901077709 1:6565816-6565838 GCTGGCTAGGAGGGCAAAGTTGG + Intronic
902381481 1:16054750-16054772 TGTGGCTCTGAGGGTAAAAGAGG - Intronic
902854836 1:19194272-19194294 ACTAGCTATAAGGGAGAAGGAGG + Intronic
906316595 1:44790326-44790348 ACTGGTGATGAGGGTAGAGGTGG - Intergenic
906633417 1:47391306-47391328 ACTGGCTTTGAAGGTAGTGGGGG + Intergenic
908107002 1:60855342-60855364 CCTGGCCATTAGGGAAAAGGTGG + Intergenic
912167560 1:107057954-107057976 AGAGGCTATGAGGGAAAAGGGGG - Exonic
912379313 1:109238669-109238691 ACTGGCTATTAGGGCAACAGTGG - Intergenic
914229112 1:145748636-145748658 ACTGTTAATGAGGGTGAAGGCGG + Intronic
917539231 1:175897492-175897514 ACTGGGGGTGAGGGTAAGGGCGG - Intergenic
918231679 1:182539153-182539175 ACTGGCTCTGGTGGTAGAGGGGG - Intronic
919405105 1:197170300-197170322 ACCTGCTATGAGGGTAAGGATGG + Intronic
920161001 1:203997556-203997578 AGTGGCTATGGGGGTAGAGTGGG - Intergenic
922080612 1:222292369-222292391 ACTGGGTATGAAGATAAAAGAGG - Intergenic
923074827 1:230601194-230601216 ACAGGCTATGATGGGAAGGGAGG - Intergenic
923499282 1:234551001-234551023 CCTGGCTCTGAGGGCTAAGGGGG - Intergenic
1063818640 10:9808241-9808263 ACTGGATATGATGGTAAATGGGG + Intergenic
1064588224 10:16861697-16861719 AGTGGGTAAGAGGGTAAACGTGG - Intronic
1065848501 10:29766285-29766307 ACAGGCTATGAGGGTTCATGTGG + Intergenic
1069807932 10:71137611-71137633 ACTGGTAATGAGGGGACAGGAGG - Intergenic
1073231395 10:101974153-101974175 ACTGCCTATGGTGGTAAAGGGGG - Intronic
1073913702 10:108377369-108377391 ACAGGCTAGTAGGGGAAAGGGGG + Intergenic
1074849961 10:117431943-117431965 GCTTGCTATGGGGCTAAAGGAGG - Intergenic
1075400491 10:122158098-122158120 ACTGGCTGTGAGATTACAGGTGG + Intronic
1076381990 10:130029798-130029820 GCTGGCTTTGAGGATGAAGGAGG - Intergenic
1077404078 11:2375016-2375038 ACTGGCTATGAGGGGGTAGGAGG - Intergenic
1079378679 11:19917518-19917540 ACTGTCTGTGAGGGTAAGAGGGG - Intronic
1084149186 11:67280266-67280288 TCTGGCTGTGAGGGTCACGGGGG - Intronic
1085038910 11:73315555-73315577 ACTGGTTCTGGGGGGAAAGGAGG + Intronic
1085707501 11:78799957-78799979 AGAGGCTATGGGGGTAAGGGTGG + Intronic
1087357325 11:97111147-97111169 ATTGGCTATCAGGGTAAACAGGG - Intergenic
1088530695 11:110806044-110806066 GCTGGATATGAGGGAAAAGGAGG + Intergenic
1088924893 11:114291804-114291826 AATGGCTAAGAGAGTAAAGGTGG - Intronic
1089939151 11:122397236-122397258 AGTGGCTATGATGGCAAAGATGG + Intergenic
1090394248 11:126408326-126408348 GCTGGCTATGAGGGTGACGTGGG + Exonic
1090918916 11:131191366-131191388 CCTGGCACTGGGGGTAAAGGAGG + Intergenic
1093652334 12:21659551-21659573 AATGGAAATGAGGGTAGAGGAGG - Intronic
1094452454 12:30597047-30597069 ACTGGCAGTGAGGGTAAAGAGGG + Intergenic
1096742199 12:53702101-53702123 ACTGGCTCTGTGGGGATAGGAGG - Intergenic
1097031941 12:56096135-56096157 GATGGCTGTAAGGGTAAAGGGGG + Intronic
1101531241 12:105575366-105575388 AGTGGCTATGATGGTAGAGAGGG - Intergenic
1106545131 13:30724526-30724548 AGTGGCTGTGATGGAAAAGGAGG + Intronic
1110444960 13:75569954-75569976 ACTAGCTAACAGGGTAAAGATGG - Intronic
1114347344 14:21809797-21809819 ACAGGGTAAGAGGGAAAAGGAGG + Intergenic
1114533897 14:23411371-23411393 GGTGGCTATGAGGAGAAAGGTGG + Intergenic
1114820298 14:26009996-26010018 ACTGGCTGTGAAGGCCAAGGGGG + Intergenic
1121160315 14:91732783-91732805 TCAGGATATGAGGGTAAAGCAGG - Intronic
1121590251 14:95100866-95100888 ACAGGCTAGCAGGGAAAAGGAGG + Intronic
1121715676 14:96072067-96072089 AATGGCCATCAGGGTTAAGGTGG + Intronic
1127353189 15:58172941-58172963 ACTGCCTATGAGGAGAAAGAGGG - Intronic
1127653229 15:61029672-61029694 ACTGGATCTGAGGGTAAAGAAGG + Intronic
1128167227 15:65476432-65476454 AGTAGATATGAAGGTAAAGGAGG + Intronic
1128625730 15:69201010-69201032 ACTGGCTTTGAAGATGAAGGAGG - Intronic
1131781735 15:95866976-95866998 ACATGATATGAGGGTTAAGGGGG + Intergenic
1132567694 16:630874-630896 ACTGGCCATGAGGGTCACCGGGG - Intronic
1134561376 16:15213012-15213034 ACTGGATATGAGAGTGAGGGAGG - Intergenic
1134921914 16:18124632-18124654 ACTGGATATGAGAGTGAGGGAGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1145905071 17:28511781-28511803 ACTCACTGTGAGGGAAAAGGGGG + Intronic
1149530075 17:57388242-57388264 ACTTCCTTTGAGGGAAAAGGGGG - Intronic
1151547505 17:74802121-74802143 ACTGGGGATGAGGGTGGAGGAGG - Intronic
1151866740 17:76808369-76808391 CCTGGCTATGACGGGAAGGGAGG + Intergenic
1152039486 17:77893708-77893730 ACTGGCTAAGAGGTTTGAGGTGG + Intergenic
1152319567 17:79600920-79600942 GCTGGCTCTGAAGGTGAAGGAGG + Intergenic
1152388573 17:79989828-79989850 AGTGGCCATGAGGGTACAGTGGG - Intronic
1152460132 17:80438250-80438272 ACAGGGTGTGAGGGTCAAGGGGG + Intergenic
1153585757 18:6618217-6618239 ACTGGTAATCAGGGAAAAGGTGG + Intergenic
1157198026 18:45635706-45635728 AGTGGCCATCAGGTTAAAGGGGG + Intronic
1157221840 18:45833793-45833815 ACCGAATATGAGGGAAAAGGTGG + Intronic
1159670493 18:71215219-71215241 TCAGGCTATGATGGAAAAGGGGG - Intergenic
1161489587 19:4554545-4554567 ACTGGCTTTTATGGTGAAGGGGG + Intronic
1165978468 19:39698574-39698596 ACTGGATGTTAGGTTAAAGGAGG - Intergenic
927098425 2:19766355-19766377 AGTGGTTATCAGGGTAAAGCAGG - Intergenic
931520080 2:63086919-63086941 ACTGTCTCTGAAGGAAAAGGTGG + Intergenic
931848052 2:66224986-66225008 GCTGACAAAGAGGGTAAAGGTGG + Intergenic
932958693 2:76386646-76386668 CCTGGCTTGGAGGGGAAAGGAGG + Intergenic
940167256 2:150787724-150787746 ATTGGCAATGAGGGAAAATGGGG + Intergenic
940536622 2:154953667-154953689 ACTGTCTATGTGGGTATAGGGGG + Intergenic
940665624 2:156605654-156605676 AGTGGCAAAGAGGGAAAAGGAGG - Intronic
942597201 2:177602384-177602406 AAGGCCTATGAGGGTAAATGTGG + Intergenic
947226136 2:227842227-227842249 TCAGGCTATGAGGGGAAGGGAGG - Intergenic
947710064 2:232308372-232308394 CCTGGCTGTGAGTGTCAAGGAGG - Intronic
947754784 2:232554106-232554128 ACTGGCCATGAGAGTATAGCTGG + Intronic
948066883 2:235087599-235087621 ACTGCCTGAGAGGGTAAAAGAGG - Intergenic
948479835 2:238242231-238242253 ACTGGATTTGAGGGGCAAGGAGG + Intergenic
948556213 2:238813271-238813293 ACTGGCTGTGAGGCTGAAAGAGG - Intergenic
1168826847 20:819727-819749 ACTGGATTTGGGGGTGAAGGTGG + Intergenic
1170183993 20:13566653-13566675 AGTGGCTATCGGGGTTAAGGTGG + Intronic
1170379431 20:15740790-15740812 ACTGGATATGAGGGTCAGAGAGG - Intronic
1174195231 20:48768085-48768107 ACTGGTTAAGAGGGGAAAGGAGG + Intronic
1174642976 20:52061239-52061261 ACTGGCTGTCAGGGAAAAGCTGG - Intronic
1175764163 20:61581540-61581562 ACTGACCATGAGGGTGGAGGAGG - Intronic
1180127446 21:45802100-45802122 AAGGGGTCTGAGGGTAAAGGAGG - Intronic
1181546106 22:23603519-23603541 CCTGGATCTGAGGATAAAGGCGG + Intergenic
1182649133 22:31836567-31836589 AGTGGCTAGGTGGGGAAAGGAGG - Intronic
1182997686 22:34829480-34829502 ACTGGGTATGATGATAAATGGGG + Intergenic
1184477609 22:44729991-44730013 CCTGGCTCTGAGGGTGATGGGGG - Intronic
1184596250 22:45516006-45516028 TGTGGCTATGAGGGTAAGGCAGG + Intronic
1185065711 22:48630871-48630893 ACTGGGTATCTGGGTATAGGGGG - Intronic
950003250 3:9673881-9673903 ACTTGCTTTTAGGGAAAAGGAGG - Intronic
951997114 3:28743592-28743614 ACTTGCTATGAGGCTACAAGGGG - Intergenic
952300369 3:32099538-32099560 ACAGAATATGAGGGGAAAGGGGG - Intergenic
955568238 3:60272882-60272904 ACTGGCAATGAGGGTAAATCAGG + Intronic
957066856 3:75530782-75530804 ATTGGATATGAGGGTAATGCTGG - Intergenic
958115080 3:89204826-89204848 AATGGCTATGAGTGTACAAGGGG + Intronic
958915165 3:100041706-100041728 CCTGGCTATGAGTGAAATGGAGG + Intronic
962695113 3:137940198-137940220 ACTGGCCATGATGGCCAAGGTGG - Intergenic
963468038 3:145707818-145707840 AATGGATATAAAGGTAAAGGTGG - Intergenic
968045843 3:195623609-195623631 TTTGGCTCTGTGGGTAAAGGTGG + Intergenic
968308813 3:197666478-197666500 TTTGGCTCTGTGGGTAAAGGTGG - Intergenic
968964843 4:3764670-3764692 ACAGGCTCTGAGGCTAAAGCTGG + Intergenic
971481165 4:27116253-27116275 AAGTGCCATGAGGGTAAAGGCGG - Intergenic
975846440 4:78530241-78530263 ACTGGCTAAAAGGATCAAGGAGG + Intronic
977527567 4:98163670-98163692 AATGGGCATGAGGGTAAAGAGGG - Intergenic
977688602 4:99877402-99877424 ATTAGCTAAGAGGATAAAGGAGG - Intergenic
977860769 4:101957250-101957272 AGTGGCTATGAGACTGAAGGAGG - Intronic
978200779 4:106021757-106021779 ACTGGCCATGATGGTACAGAAGG + Intergenic
979898295 4:126188236-126188258 ACTGGCTATGATGGAAGAGATGG - Intergenic
980102033 4:128551485-128551507 ACTGGCTTTGAAGATGAAGGAGG - Intergenic
989117948 5:37974613-37974635 ATTGGGTATGAGGTTAAAGTTGG + Intergenic
990011421 5:51003823-51003845 AGTTGCTAGGAGGGAAAAGGAGG - Intergenic
991012226 5:61895935-61895957 ACATGCTATGAGAGGAAAGGAGG + Intergenic
992647815 5:78828525-78828547 AGTTGCTATGAGAGTGAAGGAGG - Intronic
995794269 5:115925114-115925136 ACTGGGTATGAAAGTAAAAGTGG + Intergenic
995803235 5:116022741-116022763 ACTGGCAGTGATGGCAAAGGTGG - Intronic
997213129 5:132089330-132089352 ACTGGGAATGATAGTAAAGGGGG + Intergenic
997733595 5:136197778-136197800 ACTGGCAAGGAGGCTAAAGCTGG + Intergenic
1001657065 5:173359248-173359270 AAGGGCTATGTGGGCAAAGGTGG + Intergenic
1002129141 5:177068994-177069016 ACTGACTAGGAGGGGAAATGAGG - Intronic
1004014389 6:11718886-11718908 ACTGGCTTTGAGCGTCAAGGAGG - Intronic
1004474674 6:15960136-15960158 CCTGGCCATGATGGAAAAGGAGG + Intergenic
1005000394 6:21234159-21234181 AATGGCTAGGAGGGTACATGGGG - Intergenic
1005704310 6:28436197-28436219 TCTGGCAGTGAAGGTAAAGGAGG - Exonic
1012153383 6:95784250-95784272 GCTGGCTAAGTGGGTAAAGCTGG + Intergenic
1012497494 6:99850130-99850152 ACTGCCTATAGGGGAAAAGGGGG - Intergenic
1012533141 6:100263027-100263049 ACTGGCAATCTGGGGAAAGGGGG + Intergenic
1014315681 6:119861753-119861775 ACTGGCCTTGAGGGTACAGGTGG + Intergenic
1015257859 6:131200074-131200096 ACTGGGCATGAGGGTAACTGAGG + Intronic
1016475897 6:144427664-144427686 ACTTTTTATGAGGTTAAAGGAGG + Intronic
1017786777 6:157763156-157763178 CCTGGTGATGAGGGTATAGGTGG + Intronic
1020354251 7:7259686-7259708 ACTGGCTATTAGGGCAATAGGGG - Intergenic
1020421860 7:8015857-8015879 ACTGAGTATCAGGGTAACGGGGG - Intronic
1020509071 7:9029916-9029938 ACTGCCTTTGAGGAGAAAGGCGG + Intergenic
1026057416 7:66996708-66996730 ATTGGCTCAGAGGGGAAAGGGGG - Intronic
1026720692 7:72828324-72828346 ATTGGCTCAGAGGGGAAAGGGGG + Intergenic
1027631244 7:80608912-80608934 ACTGGCTATGGGGGTGGGGGTGG - Intronic
1027981719 7:85232704-85232726 ACTAGCTAAGAGTGTACAGGTGG + Intergenic
1032261917 7:130345246-130345268 ACTGGCTATGTGTGCAAAGAAGG - Exonic
1033254164 7:139785130-139785152 AGAGGCTAAGAGGCTAAAGGAGG + Intronic
1033302852 7:140201777-140201799 AGAGGCTTTGAGGGTAGAGGAGG - Intergenic
1033431686 7:141295226-141295248 ACTGGCTATGAGGGAGATGGGGG + Intronic
1037574066 8:20184507-20184529 GCTAGCTTTGAGGGTAAAAGTGG - Intergenic
1037772459 8:21810546-21810568 GCTGGCACTGAGGGTAATGGAGG + Intronic
1040552907 8:48452459-48452481 ACTTACTTTGAGGGTAGAGGAGG - Intergenic
1042784835 8:72536463-72536485 CCTGGGTTTGAGGGTAAAGCCGG - Intergenic
1047171001 8:122492199-122492221 ACTGGCTGTGTGGGTAAGGCAGG + Intergenic
1047569514 8:126082780-126082802 ACTGACTTTAAGGTTAAAGGGGG + Intergenic
1047740966 8:127806676-127806698 ACTGGCTGTGAAGGGACAGGAGG - Intergenic
1048461755 8:134626970-134626992 GCTAGCTTTGAGGGTACAGGGGG + Intronic
1048833745 8:138499066-138499088 ATTAGCTATGAGGGTGAAGATGG + Intergenic
1049030805 8:140036058-140036080 ACTGGCTACGAGGGTCCATGTGG + Intronic
1050098887 9:2097373-2097395 ACTGGTTCTTAGGGGAAAGGAGG + Exonic
1050642819 9:7686525-7686547 ACTGGGTATGAGGGTAAAATAGG + Intergenic
1053337579 9:37289447-37289469 ACTGGATATGAAAGTAAAAGAGG - Intronic
1054965918 9:71026612-71026634 AATGGCTATGAGGTGATAGGAGG - Intronic
1055150028 9:72985672-72985694 ACTGGCTTTGAGAGGAAAGATGG + Intronic
1056945242 9:90989441-90989463 ACTGGCTTTGAAGATAGAGGAGG - Intergenic
1060404707 9:123367526-123367548 CCTGGCTCTGAGGGTGCAGGTGG + Intronic
1185527110 X:788812-788834 ACACGCTAAGAGGGGAAAGGTGG + Intergenic
1188378470 X:29462694-29462716 ACTGACTATGAGGTGAAAGAAGG - Intronic
1188422835 X:30010408-30010430 CCTGGACATGAGGGTAAAGTAGG + Intergenic
1189005697 X:36992113-36992135 ACTGGATGTGGGAGTAAAGGAGG + Intergenic
1189043288 X:37565532-37565554 ACTGGATGTGGGAGTAAAGGAGG - Intronic
1189216853 X:39332676-39332698 ACAGGCTTTGAGGGCAAATGAGG - Intergenic
1192229518 X:69255555-69255577 ACTGGCTATGATGGGGGAGGGGG - Intergenic
1192695808 X:73414723-73414745 ACTGGTTTAGAGGGAAAAGGTGG + Intergenic
1194741071 X:97575033-97575055 ACTGGATATGAGGATAAAAAAGG + Intronic
1195363618 X:104107328-104107350 ACTGGCTATGAGGGTAAAGGAGG - Intronic
1195365147 X:104117431-104117453 ACTGGCCATGAGCATTAAGGAGG - Intronic
1196504619 X:116426648-116426670 ACTGGATAAGAGGGGAAAGGTGG + Intergenic
1196718064 X:118828519-118828541 TTTGGCCAGGAGGGTAAAGGAGG - Intergenic
1199249939 X:145649342-145649364 ACTGGCTTTGAAGGTAAAAATGG - Intergenic
1199844075 X:151678263-151678285 ACTGCCTATGAGGTGAAAGGAGG + Intergenic