ID: 1195364111

View in Genome Browser
Species Human (GRCh38)
Location X:104111223-104111245
Sequence CTGGGGGATTTTGATGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195364111 Original CRISPR CTGGGGGATTTTGATGTAGT AGG (reversed) Intronic
901476866 1:9495649-9495671 CTGGGGGATTTTGGTTTCGGGGG - Intergenic
902044580 1:13514885-13514907 CTGGGTTATTTTGGTCTAGTGGG - Intergenic
903453819 1:23473247-23473269 CTGGGAGATTCTGATTCAGTGGG + Intronic
903478121 1:23634492-23634514 ATGGGGGACCTTGATGTACTTGG + Intronic
903680502 1:25093243-25093265 CTGGGGGATTCTGATTCTGTAGG + Intergenic
903709146 1:25309226-25309248 CTGTGGGATTTTTAAGTAATGGG + Intronic
906897479 1:49791999-49792021 CTGGGGTAATTTTATGTTGTAGG - Intronic
907856064 1:58304787-58304809 CTGGGGGATTCTGACGCAGCAGG + Intronic
908078305 1:60545319-60545341 CTGGGCAATTTTGATGTTGTGGG - Intergenic
908603106 1:65762802-65762824 CTGGTGGGTTTTGATGCTGTAGG - Intergenic
908960437 1:69691094-69691116 CTGGGTGATTCTGAGGTAATAGG + Intronic
910205502 1:84745170-84745192 CTTGGGGATTGTGATTTAGTAGG - Intergenic
910867146 1:91799036-91799058 CTGGGAGGTTGTGGTGTAGTGGG - Intronic
914325346 1:146609486-146609508 ATAGGGGCTTTTGATGTATTTGG + Intergenic
915826256 1:159080657-159080679 CTGGGTGATTCTGATGCTGTTGG + Intronic
916937463 1:169644518-169644540 CTGGGAGATTTTAATCTAGTTGG + Intergenic
918450228 1:184650459-184650481 CTGGGAGGTTTTGATGGAGGAGG - Intergenic
918521387 1:185418767-185418789 CTGAGGGATTGTGATGCTGTAGG + Intergenic
918930477 1:190849330-190849352 CTGGTGGACTTTGATTTATTAGG - Intergenic
920709505 1:208281561-208281583 CTGGGGGATTTTTCTGAAGTTGG + Intergenic
922154571 1:223030978-223031000 CGCGTGGATTTTGATGTAATTGG + Intergenic
922724283 1:227915260-227915282 CTGGGGCCTTTTCATGTAGGTGG - Intergenic
923156331 1:231282450-231282472 CTGAGGGAATTAGATGTACTAGG - Intergenic
923970431 1:239196460-239196482 CTTGGAGATTCTGATTTAGTTGG - Intergenic
1065489271 10:26266288-26266310 CTTAGGGATTTTGATTGAGTAGG - Intronic
1067558908 10:47290858-47290880 CTGAGGGATTTTGGGGCAGTGGG - Intergenic
1067697169 10:48543677-48543699 CTGGGGGATTCTGATGCACCAGG + Intronic
1067758772 10:49027035-49027057 CTGGTGGGTTTTGAAGGAGTAGG - Intronic
1067989366 10:51193272-51193294 CCAGGTGATTTTGATGTAGATGG - Intronic
1068664098 10:59654251-59654273 CTGTGGGGTTTTTATGAAGTAGG + Exonic
1072087163 10:92091774-92091796 ATTGGGGATTTTGTTGTTGTTGG + Intronic
1072271951 10:93785516-93785538 CTGGTGGATTTGGACGAAGTTGG + Intronic
1072919327 10:99562626-99562648 CCTGGGGATTTTGATGCAGGTGG + Intergenic
1073106787 10:101036775-101036797 CAGGGGGATGTTGATGCAGTTGG - Exonic
1075827117 10:125368116-125368138 ATGAGAGATTCTGATGTAGTAGG + Intergenic
1076265214 10:129104196-129104218 CTGGTGGATTCTGATGGTGTTGG + Intergenic
1076863676 10:133156289-133156311 CTGTGGGGTATTGATGTCGTTGG + Intergenic
1076863687 10:133156363-133156385 CTGTGGGGTATTGATGTCGTTGG + Intergenic
1077034970 11:490134-490156 CTGTGGGAGTTTGGTGTCGTTGG + Intronic
1080160085 11:29163292-29163314 CTGGGGGAAGTTGAGGTAGGAGG - Intergenic
1085881603 11:80473851-80473873 CTGGGTGACTTTGCTGTAGGTGG - Intergenic
1090387862 11:126366955-126366977 CTTGGGGATTTTGGGGTACTGGG + Intronic
1090390507 11:126384424-126384446 CTTGGGGATTTTGGGGTACTGGG + Intronic
1092362051 12:7845450-7845472 CTGGGAGATTCTGATGTTGCTGG - Intronic
1093471673 12:19508743-19508765 CTGGAGTTTTTTGCTGTAGTTGG - Intronic
1094759886 12:33520432-33520454 CTCGGGGTTATTCATGTAGTAGG + Intergenic
1095455943 12:42385851-42385873 CTGGGAGCTTTTGGTGTAATGGG + Intronic
1095527210 12:43141286-43141308 CTGGTGACTTTTGCTGTAGTTGG - Intergenic
1097406821 12:59199267-59199289 CTGGGATATTTTGATGGTGTTGG - Intergenic
1097679460 12:62634904-62634926 CTGGGGGATTCTGATTTAATTGG + Intergenic
1097684850 12:62681667-62681689 CTAGGGGATTTGGATATAGGAGG - Intronic
1099262947 12:80407383-80407405 CATGGGGATTATGATGTAGCAGG - Intronic
1100272706 12:93041699-93041721 ATGGTGGATTTTGTTTTAGTTGG + Intergenic
1101800296 12:108016105-108016127 ATGGAGGATTATGATGGAGTGGG + Intergenic
1103198767 12:119069307-119069329 CTTGGGGATTCTGATCTAATTGG - Intronic
1115536162 14:34375532-34375554 CTGGGGGATTGTGAGTCAGTAGG - Intronic
1120052864 14:79888406-79888428 CTGGGTGATTCTGATGTAATTGG + Intergenic
1121671971 14:95717052-95717074 CTCGGAGATTCTGATGTAATTGG - Intergenic
1125514930 15:40313236-40313258 CTGGATGATCTTGAAGTAGTTGG + Intergenic
1126802491 15:52311446-52311468 CTGGGAGAATTTGATGCAATTGG + Exonic
1127328907 15:57920080-57920102 ATGGGGGAATTGGACGTAGTCGG + Intergenic
1127459987 15:59189957-59189979 CTTGGGGATGCTGATTTAGTAGG + Intronic
1127976371 15:64000260-64000282 AAGGGGGAGTTTGCTGTAGTGGG - Intronic
1129465685 15:75723038-75723060 CTCTGCTATTTTGATGTAGTAGG + Intergenic
1131074435 15:89486389-89486411 CTGGGCGATTTTGATGTGCCGGG + Intronic
1133734880 16:8607407-8607429 CTGGGGGAGTTGGATGTGGGAGG - Intergenic
1134596213 16:15498132-15498154 CAGGGAGATTTTGATTCAGTAGG + Intronic
1136189266 16:28606096-28606118 CTGGGGGACGGTGGTGTAGTTGG + Exonic
1136317766 16:29464278-29464300 CTGGGGGACGGTGGTGTAGTTGG - Exonic
1136432341 16:30203623-30203645 CTGGGGGACGGTGGTGTAGTTGG - Exonic
1138144922 16:54599826-54599848 CTTGGGGATTCTGATTTAATTGG + Intergenic
1140008215 16:71101461-71101483 ATAGGGGCTTTTGATGTATTTGG - Intronic
1141622300 16:85242714-85242736 CCTGGGGATTCTGATGTAATTGG + Intergenic
1142127322 16:88416736-88416758 CTGCGGGGTTTTGATTTTGTGGG - Intergenic
1145961841 17:28891271-28891293 CTGGGGGAGTTTCATGCAGCTGG + Intronic
1146698438 17:34930697-34930719 CTGGGAGCTTATGTTGTAGTGGG - Intronic
1147120343 17:38331769-38331791 CTGGGGCATTGTGGTCTAGTGGG + Intronic
1147277576 17:39331896-39331918 CTGAGGTATTTTGTTGTAGCAGG - Intronic
1148218120 17:45845037-45845059 CCGGGGGAGGGTGATGTAGTCGG - Exonic
1149665485 17:58362414-58362436 CTGGGGTATTTTGATGTAAATGG + Intronic
1149783179 17:59414327-59414349 CTGGGGATTTTTGCTATAGTGGG - Intergenic
1149880162 17:60281802-60281824 CAGGGTGATTTTGATGTAGATGG - Intronic
1150191860 17:63250557-63250579 CTGGGTTATTTTGAAGGAGTTGG - Intronic
1150207456 17:63419863-63419885 CTGGGGTATTTCGGTTTAGTTGG - Intronic
1151682205 17:75628159-75628181 CTGGGGTATGTGGGTGTAGTGGG - Intronic
1152645276 17:81465765-81465787 CTGGGGGCTTATGTTGTGGTCGG + Exonic
1152866543 17:82727026-82727048 CTTGGGGATTTTGCCGTGGTAGG - Exonic
1154424953 18:14264992-14265014 TTGGGGGATTGTGGTGCAGTTGG + Intergenic
1155757738 18:29522788-29522810 CTTGGGCATTTTGCTGTAATGGG - Intergenic
1157998900 18:52593330-52593352 CTGAGGGAGTTTTACGTAGTGGG - Intronic
1158558737 18:58496276-58496298 AGGAGGGATTATGATGTAGTGGG - Intronic
1160594595 18:79964840-79964862 CTGGGGGGTTTTGAGGTCCTGGG + Intronic
1164940653 19:32250584-32250606 CTGGAGCATTTTGGTGGAGTGGG + Intergenic
925344517 2:3161249-3161271 CTGGGGAAGGTTGATGGAGTTGG - Intergenic
925402315 2:3584468-3584490 CTTGGGGAGTTTGATGTGGTGGG + Intergenic
925475811 2:4213150-4213172 CATTGGGATTTTGATGGAGTCGG + Intergenic
930214429 2:48680070-48680092 CTGGGGAATTGTGAGGAAGTAGG + Intronic
930753853 2:54956694-54956716 GTGGTGGGTTTTGATGTAGCTGG - Intronic
931771080 2:65498756-65498778 CTGGGGGGTATTTTTGTAGTTGG + Intergenic
931811878 2:65862167-65862189 CTGGGAGATTCTGATCTAATTGG + Intergenic
932763851 2:74457961-74457983 CTGGGGGAGTGGGATGTTGTGGG + Intronic
938165012 2:129018495-129018517 CTTGGGAATTTGGTTGTAGTTGG - Intergenic
938209324 2:129453642-129453664 CTGGGGCCTTTTGAGGGAGTTGG + Intergenic
938691095 2:133790101-133790123 ATGGTGCATTTTAATGTAGTTGG - Intergenic
940130478 2:150375776-150375798 CTGGGGGATTCTGATATATTTGG - Intergenic
941294913 2:163725514-163725536 CTGTGGCATTTTGCTGTAGTAGG + Intronic
942250901 2:174047027-174047049 CTGGGGGTGTTTGGTGAAGTGGG + Intergenic
942404539 2:175640228-175640250 CTGGGTAATTATGATGCAGTTGG - Intergenic
943961548 2:194270916-194270938 CTGGGTGATTTTCATTTACTTGG - Intergenic
944939623 2:204609525-204609547 CTGGGATATCTTGAAGTAGTCGG + Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1171369084 20:24649018-24649040 CTTGGGGATTATGGTCTAGTGGG + Intronic
1173823936 20:46035453-46035475 CTGGGGCAGGTTGGTGTAGTTGG - Exonic
1173973972 20:47173390-47173412 CCGGGGGATGCTGATGTGGTTGG - Intronic
1174489741 20:50884449-50884471 CTTGGAGATTCTGATGTAATTGG - Intergenic
1175715074 20:61249937-61249959 CTGGGGGATCTTGATGCTGCTGG + Intergenic
1179253106 21:39690538-39690560 CTGAGAGATTTTGATTTAATTGG + Intergenic
1181906931 22:26205562-26205584 CTGGGTGATTCTGATGTAGGTGG - Intronic
1183219605 22:36504187-36504209 CTGGGGGAGGGTGATGGAGTCGG + Exonic
1185218936 22:49619238-49619260 CTGGGGGCTTTTGAGTTAGGCGG + Intronic
949188882 3:1226977-1226999 TTTGGGGATTTTGATGGAGTTGG + Intronic
949978943 3:9487826-9487848 GTGGGGAATATTGATGTAGGGGG + Intergenic
950146721 3:10655388-10655410 CTGGGGGATTCTGATTGAGCAGG - Intronic
954004721 3:47581629-47581651 CCGGGGGTTTTTCATGCAGTCGG - Intergenic
954961134 3:54566017-54566039 CTGGTGGAGTTTGATCTAATGGG - Intronic
955245881 3:57224582-57224604 CTGGAAGATTTTGGTGTAGTAGG - Intronic
955389579 3:58511220-58511242 GAGGGGAATTTTGATGTTGTTGG - Intronic
959346202 3:105197715-105197737 CTGGAGGATAATAATGTAGTTGG + Intergenic
959576496 3:107939960-107939982 CTTTGGGATGTTGATTTAGTAGG + Intergenic
960083052 3:113561665-113561687 CTGGGGGATTCTGATGTACATGG - Intronic
960541680 3:118868834-118868856 CTTGCAGATTTTGATCTAGTAGG - Intergenic
961511403 3:127406015-127406037 GTGGGGTATTTTGAAGTACTGGG - Intergenic
963321315 3:143812655-143812677 CTGGGGGATTTTTAGGGACTAGG - Intronic
965684342 3:171285851-171285873 CTTGGTGATTCTGATGTAGTCGG + Intronic
970682057 4:18520715-18520737 ATGGGGTATTTTTATTTAGTGGG - Intergenic
972398104 4:38674298-38674320 TTGGGGGATTTTGAAGAATTTGG + Intronic
973815716 4:54617149-54617171 CTGGGAGATTTTGATGTGGAAGG + Intergenic
975765572 4:77664096-77664118 ATTGGGGAATTTGATGTAATAGG + Intergenic
981311560 4:143302803-143302825 CTGGGGGATTTAAATGCAGAGGG - Intergenic
982003785 4:151045865-151045887 TTAGGTGATTTTGATGTTGTGGG - Intergenic
986563257 5:9085037-9085059 CTGTGGGATTTTGAAGTTGAGGG + Intronic
992320558 5:75609467-75609489 CTGGGAGATTTTTCTGTACTTGG + Intergenic
992840056 5:80679933-80679955 CATGAGGATTTTCATGTAGTAGG + Intronic
993198024 5:84775462-84775484 CTGGTGTATTTTGTTGTGGTTGG - Intergenic
994545351 5:101159952-101159974 CTGGGTGATTTGGATATAGAGGG + Intergenic
995782775 5:115795730-115795752 CTGGGGGATTCTGATGCTGAAGG - Intergenic
996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG + Intronic
997204911 5:132042141-132042163 CTGGGGGATTATCTTCTAGTGGG + Intergenic
998478416 5:142441120-142441142 CTGGGGGATGTTGGTGTTGGTGG - Intergenic
998725634 5:145010217-145010239 CTAGGGGAATCTGATGTAGATGG + Intergenic
1000090326 5:157924540-157924562 CAGTGGGAGTTTGATGTAATGGG + Intergenic
1000848634 5:166312509-166312531 CTCAGTGATTTTGATTTAGTAGG - Intergenic
1001146905 5:169192983-169193005 CTGGGGGTTTATGATTTTGTGGG - Intronic
1001254573 5:170173608-170173630 TTGGGGGATATTGATGTTTTGGG - Intergenic
1002166133 5:177347622-177347644 CCAGGTGATTCTGATGTAGTTGG - Intronic
1003520096 6:6850968-6850990 CTGAGGCATTTAGATTTAGTTGG - Intergenic
1008746076 6:54670992-54671014 CTAGGGGATTTTCATGGGGTTGG - Intergenic
1009796847 6:68480154-68480176 CTAAGGTATTTTGATGTAGCAGG + Intergenic
1010233117 6:73553068-73553090 CTGGGTAATTCTGATGTATTTGG - Intergenic
1010584810 6:77644470-77644492 AGGGGGGATTTTGCTTTAGTTGG + Intergenic
1011779275 6:90768986-90769008 CCGGTGGATTTTGATTTATTTGG - Intergenic
1012253086 6:97001228-97001250 GTGGGGCATGTTGATGGAGTAGG + Intronic
1012430136 6:99155498-99155520 CTCTGGGATTCTGATGTAGTTGG - Intergenic
1013207306 6:107957166-107957188 GTAGGGAATTTTGAGGTAGTGGG - Intronic
1015753161 6:136581636-136581658 CTAGGGGAGTTTGATGAAGATGG - Intronic
1017058277 6:150457051-150457073 CTGAGGGGTTTTGCTGTAGCAGG - Intergenic
1020184222 7:5946652-5946674 CTGAGGGATTGTGATGTAGACGG - Intronic
1020298695 7:6778114-6778136 CTGAGGGATTGTGATGTAGACGG + Intronic
1020745362 7:12072670-12072692 CAGGCTGATTTTGATGTACTGGG - Intergenic
1023951021 7:44845595-44845617 CTGGGGAATTTTGTAGTTGTTGG - Intronic
1024178940 7:46869600-46869622 CTGGGGGATTTGGGTGCAGGTGG - Intergenic
1028220966 7:88195995-88196017 CAGAGAGATTTTGATTTAGTTGG + Intronic
1030695715 7:112582734-112582756 CTGAGAGATTCTGATTTAGTAGG + Intergenic
1031976421 7:128096490-128096512 CCAGGTGATTCTGATGTAGTTGG - Intergenic
1032969687 7:137146347-137146369 CTGAGGGATTTTGTTTTTGTAGG + Intergenic
1033057800 7:138075691-138075713 CTGGGAGATTTGGATGCAGCAGG - Intronic
1033936522 7:146592560-146592582 CTGGAGGATTTTCATGTATGAGG - Intronic
1034330748 7:150280185-150280207 CTGGGAGATTCTGATGTAATTGG - Intronic
1034667296 7:152829664-152829686 CTGGGAGATTCTGATGTAATTGG + Intronic
1035450722 7:158975488-158975510 CTGGGGGCTTTTTGTGCAGTGGG - Intergenic
1039417949 8:37411698-37411720 CTGGGAGATCTTGCTGTAGCCGG - Intergenic
1042009211 8:64221110-64221132 CTGTGGGATTTTGAAGGAATTGG + Intergenic
1042373068 8:68014813-68014835 CTATGCGATTCTGATGTAGTTGG - Intronic
1047187618 8:122648158-122648180 CTGGGAGCTTTTGAACTAGTAGG - Intergenic
1047872482 8:129099773-129099795 CTGGGGGGTTTTTATATACTTGG + Intergenic
1047915795 8:129582548-129582570 CTGGGGCATTGTGATGAAGGAGG - Intergenic
1048102236 8:131365418-131365440 CTCGGGGATTTAAGTGTAGTAGG - Intergenic
1050594786 9:7194641-7194663 TTGGGGGATTTTGAGGCACTAGG + Intergenic
1051488123 9:17630795-17630817 GTGGGGGAGTTGGAGGTAGTAGG + Intronic
1052987780 9:34500880-34500902 CTGGGGGTTTGGGATGTAGAGGG - Intronic
1055004045 9:71485136-71485158 CTTGGAAATTTTGTTGTAGTGGG + Intergenic
1055519526 9:77066209-77066231 TTGGGGGATGTTGATGTAAATGG + Intergenic
1056092669 9:83219547-83219569 CTGGGAGATTTTGATTTAGCAGG - Intergenic
1056673439 9:88651812-88651834 CTGGGTGATTTTGATGCTGCTGG + Intergenic
1057779814 9:98040395-98040417 CTCGGGGCCTTTGATGTTGTGGG + Intergenic
1058875713 9:109243255-109243277 CTTGGGGATTTTGTTGTCATGGG - Intronic
1061953980 9:133952096-133952118 CTGGGGCCTTTTGAGGTAATTGG - Intronic
1185712003 X:2312020-2312042 CGTGGGGATTTTGATGCCGTTGG - Intronic
1187066198 X:15840698-15840720 GTGGGGGGTGGTGATGTAGTTGG - Intronic
1187096988 X:16159521-16159543 CTGGCTGATTCTGATGTAGATGG - Intergenic
1187826846 X:23340080-23340102 CTGGGTAATTTTGTTGTTGTGGG - Intronic
1188839411 X:34997160-34997182 CCAGGGGATTTTGTTGTACTTGG + Intergenic
1190515083 X:51215537-51215559 CTAGGGGATTTTAATATGGTGGG + Intergenic
1194758154 X:97762349-97762371 TTGAGAGATTCTGATGTAGTAGG - Intergenic
1195342682 X:103920333-103920355 CTGGGGGATTTTGATGTACTAGG + Intronic
1195364111 X:104111223-104111245 CTGGGGGATTTTGATGTAGTAGG - Intronic
1196347802 X:114686258-114686280 CTGGGGGATGTTGACCCAGTGGG - Intronic
1198229669 X:134677080-134677102 CCAGGAGATTTTGATGCAGTAGG + Intronic