ID: 1195364217

View in Genome Browser
Species Human (GRCh38)
Location X:104112163-104112185
Sequence ACCTTTGTATAGGGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195364217_1195364225 26 Left 1195364217 X:104112163-104112185 CCCGCTTCCCCCTATACAAAGGT 0: 1
1: 1
2: 0
3: 7
4: 104
Right 1195364225 X:104112212-104112234 TCTGTCCCACCTCGTGTTTAAGG 0: 1
1: 1
2: 0
3: 6
4: 55
1195364217_1195364224 1 Left 1195364217 X:104112163-104112185 CCCGCTTCCCCCTATACAAAGGT 0: 1
1: 1
2: 0
3: 7
4: 104
Right 1195364224 X:104112187-104112209 AGGAACTCTCATTGTTCACTTGG 0: 2
1: 0
2: 1
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195364217 Original CRISPR ACCTTTGTATAGGGGGAAGC GGG (reversed) Intronic
902733765 1:18386660-18386682 TCCTTTGAAGAGTGGGAAGCAGG - Intergenic
905455427 1:38084924-38084946 GACTCTGGATAGGGGGAAGCTGG + Intergenic
906545546 1:46616982-46617004 TCCTTTGTCCAAGGGGAAGCTGG - Intergenic
910677739 1:89831836-89831858 ATGTTTGCATAGGGGAAAGCTGG + Intronic
916366675 1:164036334-164036356 AGCTTGGTATAGGGGGATGTCGG + Intergenic
919322790 1:196064512-196064534 GCCTATGTATAGGAGAAAGCTGG - Intergenic
919916216 1:202141082-202141104 ACCTTGGCAGAGGGGGATGCTGG + Intronic
923437703 1:233983335-233983357 ACCTTATTATAGGAGGAAGGTGG + Intronic
924415807 1:243855503-243855525 AACTTTGTAGTGGGGAAAGCAGG + Intergenic
1068509459 10:57945730-57945752 ACTTTTGTAGAGGAGGAAGTTGG + Intergenic
1068848073 10:61703758-61703780 AACTGTGTGTAGGGGGCAGCAGG - Intronic
1069255487 10:66326691-66326713 ACGTGTGTATTGGGGGTAGCGGG + Intronic
1070646899 10:78208078-78208100 ACCATTGCAGAGGAGGAAGCTGG - Intergenic
1070770047 10:79077028-79077050 TCCTCTGTGTATGGGGAAGCAGG + Intronic
1072243441 10:93519392-93519414 ACCTTTTTTAAGGGGGAAGAAGG - Intronic
1072261325 10:93677486-93677508 ACCTTTGGATATTGGGAAGCAGG - Intronic
1072685485 10:97534089-97534111 ACCTTTGTCTTAGGGGAAGGCGG - Intronic
1075222382 10:120596418-120596440 ACCTTCTTATAGGGGGAATCTGG - Intergenic
1075276150 10:121094344-121094366 AACTTTCTATAGGCAGAAGCAGG - Intergenic
1078894311 11:15584601-15584623 ACATTTGTGTAGGGTGAGGCGGG + Intergenic
1079598438 11:22283122-22283144 ACCTTTGAGGAGGAGGAAGCAGG - Exonic
1079987433 11:27213730-27213752 ACTTTTATAAAGGGAGAAGCTGG - Intergenic
1084225998 11:67715173-67715195 GCCTTTGTATAGAGAGGAGCAGG - Intergenic
1084263829 11:67995047-67995069 GCCTTTGTATAGAGAGGAGCAGG - Intronic
1084661798 11:70550462-70550484 ACCCTGGTATAGTGAGAAGCAGG - Intronic
1084809583 11:71604071-71604093 GCCTTTGTATAGAGAGGAGCAGG + Intergenic
1086230591 11:84565164-84565186 ACCTGTGTATATGGACAAGCTGG - Intronic
1087111629 11:94475963-94475985 CCTTTGGGATAGGGGGAAGCAGG + Intronic
1090176739 11:124656756-124656778 CCCTTTGTTTTGGGAGAAGCTGG - Intronic
1091724173 12:2834250-2834272 ACCTGTGGTTCGGGGGAAGCAGG + Intronic
1092010430 12:5106031-5106053 ACCTTTGTCTATGGGGATGTTGG - Intergenic
1093143844 12:15541065-15541087 ACCTATGTATATGGGTAAGGGGG - Intronic
1095862617 12:46934837-46934859 ACCTATGTACAAAGGGAAGCAGG + Intergenic
1096500299 12:52060580-52060602 AGCTGTGGATGGGGGGAAGCAGG + Intergenic
1105269545 13:18858946-18858968 TCCTTTTTTGAGGGGGAAGCTGG - Intergenic
1105553453 13:21421059-21421081 ACCTCTTTGGAGGGGGAAGCGGG + Exonic
1105674196 13:22652648-22652670 ACCTATGTATAGGAGAAGGCGGG - Intergenic
1106676795 13:31968387-31968409 ATCTGTGTATAGAGGGAAACTGG - Intergenic
1130669351 15:85898039-85898061 ACCGTTGAATTGGGGGATGCAGG - Intergenic
1134029920 16:10983833-10983855 ACCTTTGAAAAGAGGGAACCAGG - Intronic
1138788766 16:59877480-59877502 ACCTTTATAAATGGGGAAGATGG - Intergenic
1140889387 16:79272105-79272127 ACCTTTGCCTAGTGGGCAGCAGG + Intergenic
1141166666 16:81665447-81665469 ACCTGTGCATAGGAGGAATCTGG + Intronic
1142481904 17:224232-224254 ACCTTTAAAGAGGGTGAAGCTGG - Intronic
1142815766 17:2424019-2424041 ACCATTGTATATGGGAAAGTTGG - Intronic
1143868219 17:9939466-9939488 CCCTTTGTCTAGGGGCAGGCTGG - Intronic
1146955418 17:36934339-36934361 ACCTAGGTATAGGGGAAAGAAGG - Intergenic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1149583433 17:57767724-57767746 ACCCTTGTACAGGGGAGAGCAGG + Intergenic
1150365399 17:64578250-64578272 ACTTTTTTTTAAGGGGAAGCAGG + Intronic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1161384859 19:3985483-3985505 AGCTTTTTATAGGCGGACGCCGG + Intergenic
1166777653 19:45322695-45322717 GCCTTTGTATAGGAGGATGTTGG + Intronic
934498765 2:94836203-94836225 TCCTTTTTTGAGGGGGAAGCTGG - Intergenic
934994885 2:98948766-98948788 CCGTTTGTATATGAGGAAGCAGG - Intergenic
939405960 2:141756296-141756318 ACCCTTCTATTGGGGAAAGCTGG - Intronic
944535072 2:200700917-200700939 ACCTTAGTTCATGGGGAAGCAGG + Intergenic
1175468956 20:59211959-59211981 ACCTTTGTGTAGGTGGAGGTGGG + Intronic
1176854801 21:13958258-13958280 TCCTTTTTTGAGGGGGAAGCTGG - Intergenic
1178501030 21:33125571-33125593 GGCTTTGGATAAGGGGAAGCAGG + Intergenic
1180241720 21:46511881-46511903 AACTTTGTATAAGGGGAATCAGG + Intronic
1181416325 22:22762105-22762127 ACCTTTGTAGAGGGTGAGGAAGG - Intronic
950174164 3:10860726-10860748 ATCCTTGAAGAGGGGGAAGCAGG + Intronic
952998121 3:38904951-38904973 ACCTGGGTAGAGGTGGAAGCTGG - Intronic
953187139 3:40648579-40648601 ACATTTGTATAAGGAGTAGCAGG + Intergenic
954218269 3:49136348-49136370 ACCTTTGTCTGTGGGGAAGAGGG + Intergenic
955467277 3:59250411-59250433 ACTTTTGTATAGAGTGAACCAGG + Intergenic
956413567 3:69003717-69003739 ACCTTTGGAGAGGGGGATGGGGG + Intronic
957079260 3:75623001-75623023 GCCTTTGTATAGAGAGGAGCAGG - Intergenic
963018080 3:140844797-140844819 ACCATGGTAGAAGGGGAAGCAGG + Intergenic
965380377 3:167980948-167980970 ATCTTTCTTTAGGGAGAAGCAGG - Intergenic
966511688 3:180771345-180771367 AACTTTGTGGAGGTGGAAGCTGG + Intronic
968089816 3:195892952-195892974 AGCTTTGTGTATGGGGAGGCAGG - Intronic
968566955 4:1318108-1318130 GCCTGTGCATTGGGGGAAGCCGG - Intronic
969731525 4:8960437-8960459 GCCTTTGTATAGAGAGGAGCAGG + Intergenic
970016734 4:11520465-11520487 ACCTTGCTAGAGAGGGAAGCAGG - Intergenic
979510995 4:121553420-121553442 ACCTTTGAATAAGGGGAAGGGGG - Intergenic
980485797 4:133456378-133456400 ACCTTTGTTGAAGGGGAGGCCGG + Intergenic
986253986 5:6086544-6086566 ACCTTTGAAAAGGGGGCAGGAGG - Intergenic
987514659 5:18889690-18889712 ACCATTGCAGAAGGGGAAGCAGG + Intergenic
990581719 5:57172909-57172931 ACATTTGTTTAGAGGGAAGGTGG - Intergenic
991091091 5:62694693-62694715 ACCTATGTATTGGAGAAAGCTGG + Intergenic
994544316 5:101143796-101143818 ATCTTTGCAGAAGGGGAAGCAGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998854957 5:146385763-146385785 ACCTTTGTCTAGGGAAAAGAAGG - Intergenic
999778844 5:154832818-154832840 ACCTATGTATATGGAGAAGGTGG - Intronic
1000362701 5:160462718-160462740 GAGTTTGTAGAGGGGGAAGCAGG + Intergenic
1004891664 6:20106852-20106874 ACCTTTGTTTAGGATGAAACAGG - Intronic
1007190921 6:40017763-40017785 ATCATTGTTTGGGGGGAAGCAGG - Intergenic
1010391806 6:75346447-75346469 ATTTTTGTATAGGTGGAATCTGG + Intronic
1020309772 7:6858998-6859020 GCCTTTGTATAGAGAGGAGCAGG - Intergenic
1024544810 7:50508326-50508348 ACATTTGTGCAGGGGGAAGGAGG + Intronic
1030377621 7:108771506-108771528 ATCTGTGTTTAGTGGGAAGCAGG + Intergenic
1034544465 7:151780987-151781009 AGATTTGTTTAGGGGGAAGTGGG + Intronic
1045372996 8:101543589-101543611 AGCTTTGTAGATGGGGAAGCAGG - Intronic
1045744025 8:105395613-105395635 ACCATTGTATGGGGGGAAATAGG - Intronic
1048934010 8:139340351-139340373 ACCTCTGTGTAGGAGTAAGCTGG - Intergenic
1051737151 9:20212295-20212317 TCCTTTGTATATTTGGAAGCAGG - Intergenic
1053658395 9:40244350-40244372 TCCTTTTTTGAGGGGGAAGCTGG + Intronic
1054526203 9:66131871-66131893 TCCTTTTTTGAGGGGGAAGCTGG - Intronic
1054678146 9:67880380-67880402 TCCTTTTTTGAGGGGGAAGCTGG + Intronic
1060027468 9:120185239-120185261 ACCTTTTTTGAGGGGGAAACTGG - Intergenic
1186310616 X:8314045-8314067 TCCATTATATAGGGGGAAGCCGG + Intergenic
1187120805 X:16404515-16404537 GGCATTGTAGAGGGGGAAGCAGG + Intergenic
1187675319 X:21710735-21710757 AACTGTGAAGAGGGGGAAGCTGG + Intronic
1190260185 X:48792482-48792504 TCCTGTGTATAAGGTGAAGCAGG - Intronic
1195342580 X:103919423-103919445 ACCTTTGTATAGGGGGAAGGGGG + Intronic
1195364217 X:104112163-104112185 ACCTTTGTATAGGGGGAAGCGGG - Intronic
1195450872 X:105011142-105011164 ACCTTTACATATGAGGAAGCAGG - Intronic
1196717195 X:118823465-118823487 ACCTTGGTATAGGGAAAAGACGG - Intergenic
1199554376 X:149090550-149090572 ACCTTCTTATAGGAGGAAGAGGG - Intergenic
1199655341 X:149989401-149989423 AACTCTGTATAGGGAGCAGCAGG - Intergenic
1200775145 Y:7163934-7163956 CCCTTTGTATGGGGTGAAGCTGG + Intergenic