ID: 1195365036

View in Genome Browser
Species Human (GRCh38)
Location X:104116914-104116936
Sequence GTAGGTATATGGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195365036 Original CRISPR GTAGGTATATGGATGGAGCA GGG (reversed) Intronic
901863625 1:12090024-12090046 GTAGATAGATGGATGGGGAAAGG - Intronic
901863652 1:12090133-12090155 GTAGATAGATGGATGGGGAAAGG - Intronic
901863676 1:12090230-12090252 GTAGATAGATGGATGGGGAAAGG - Intronic
902416264 1:16241532-16241554 GTATGGATTTGGGTGGAGCAGGG + Intergenic
902644365 1:17788316-17788338 GTAGGCATGTGGCAGGAGCAGGG - Intronic
902722855 1:18315650-18315672 ATGGGTAGATGGATGGAGAATGG + Intronic
902939581 1:19791005-19791027 GCAGGGATATGGATGGAGCTGGG + Intronic
904878712 1:33677805-33677827 GTAGGGACATGGATGAAGCTGGG + Intronic
906659290 1:47571273-47571295 GTAGGTAAGTGGCTAGAGCATGG - Intergenic
906804448 1:48766743-48766765 GTAAGTATTAGGATGGAGCCAGG - Intronic
906942025 1:50263858-50263880 GGAGGTATATAGGTGGAGCCAGG - Intergenic
907638524 1:56160831-56160853 GTAGGTATAGGACTGGAGAAAGG - Intergenic
907814682 1:57906659-57906681 GTAATTATATTGATGGACCATGG + Intronic
907955111 1:59220809-59220831 GTAGGTATTTGAATGGAGAGGGG + Intergenic
909048259 1:70736775-70736797 GTAGGGACATGGATGAAGCTGGG + Intergenic
909051010 1:70768012-70768034 GCAGGAACATGGATGGAGCTGGG - Intergenic
909084175 1:71152134-71152156 GTAGGGACATGGATGAAGCTGGG + Intergenic
910209903 1:84782489-84782511 GTATAAATATGGATGGAGCGTGG - Intergenic
913710950 1:121482960-121482982 GTAGGGACATGGATGAAGCTGGG + Intergenic
917290425 1:173466967-173466989 TTAGGGACATGGATGGAGCTGGG + Intergenic
918011890 1:180594518-180594540 GTAGGCATTTGGATGGAGGGTGG - Intergenic
918504644 1:185238499-185238521 GTAGGTATTTGTGTAGAGCAAGG + Intronic
918906617 1:190504701-190504723 GCAGGGAAATGGATGGAGCTAGG - Intergenic
918928253 1:190815923-190815945 GCAGGAATATGGATGGAACTGGG + Intergenic
922745792 1:228042911-228042933 GTAGATATATGGATGATGGATGG + Intronic
922916594 1:229263112-229263134 TTAGGCATGGGGATGGAGCAGGG + Intergenic
924630975 1:245740561-245740583 GCAGGAACATGGATGGAGCTGGG + Intergenic
924675888 1:246177587-246177609 GTAGGTATATTAAATGAGCAAGG + Intronic
924953000 1:248902694-248902716 GCAGGGAGATGGATGGAGCTGGG + Intergenic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062975623 10:1680388-1680410 GTATGTATGTGGGTGGAGAAGGG - Intronic
1063591145 10:7396744-7396766 GTAGGGACATGGATGAAGCTGGG + Intronic
1065256599 10:23875796-23875818 GCAGGGACATGGATGGAGCTGGG + Intronic
1067174826 10:43938224-43938246 GTAAATATATGGATGGGGGAGGG + Intergenic
1067259752 10:44679065-44679087 GTAGGTATGTGAAGGGACCATGG - Intergenic
1067369688 10:45672227-45672249 GTAGGTACCTGGATGGCGCGAGG - Intronic
1068528952 10:58163351-58163373 GAAGGTTTATGAAAGGAGCAAGG + Intergenic
1068556366 10:58463679-58463701 TTAGGTCAATGGATGAAGCAGGG - Intergenic
1070223777 10:74478813-74478835 GTACTTATAAGGATGGAGAATGG - Intronic
1071755295 10:88531222-88531244 GTAGGAATATTGATAAAGCAAGG - Intronic
1072842654 10:98792618-98792640 GTAGGAATTTGTATGGAGCTGGG - Intronic
1073450231 10:103604751-103604773 GTAGGTACAGGGCTGGGGCAGGG - Intronic
1075898460 10:126018873-126018895 GGAGGCATACGGCTGGAGCAAGG - Intronic
1076862938 10:133150452-133150474 GTGGGAAAATGGATGGAGCTGGG + Intergenic
1077625679 11:3769330-3769352 GTGGGTATATGGCTTGAGCCTGG + Intronic
1079105145 11:17566642-17566664 TTAGGTAAATGGATGGTGTATGG - Intronic
1079751036 11:24197562-24197584 GCAGGAACATGGATGGAGCTGGG - Intergenic
1080096035 11:28408002-28408024 GCAGGGACATGGATGGAGCTTGG + Intergenic
1080153537 11:29079960-29079982 GCAGGGACATGGATGGAGCTGGG + Intergenic
1080169891 11:29288082-29288104 GTAGGGACATGGATGAAGCTGGG - Intergenic
1086775205 11:90822451-90822473 GTAGTTAAATGGATGGAGAATGG - Intergenic
1087982549 11:104634064-104634086 GGAGTTCTATGGATGGAGAAGGG + Intergenic
1088929437 11:114335592-114335614 GAAAGTAAATGGATGGAGAAAGG + Intergenic
1089661937 11:119991643-119991665 GTAGGAAAATGGCAGGAGCAGGG + Intergenic
1091987646 12:4925599-4925621 GTAGGGACATGGATGAAGCTGGG + Intronic
1092661515 12:10743580-10743602 GTAGGGACATGGATGAAGCTGGG - Intergenic
1094225988 12:28046821-28046843 GCAGGAACATGGATGGAGCTGGG + Intergenic
1097364526 12:58696604-58696626 GCAGGAACATGGATGGAGCTGGG + Intronic
1100196670 12:92254015-92254037 GCAGGGACATGGATGGAGCTGGG - Intergenic
1101481761 12:105104920-105104942 GCAGGAACATGGATGGAGCTGGG - Intergenic
1102856099 12:116295468-116295490 ATGGGTAGATGGATGGAGGATGG + Intergenic
1103563111 12:121803024-121803046 GTAGGTAATTGGCTGGAGCAGGG - Intronic
1104334507 12:127880839-127880861 GTAGGTAGGTGGATGGGGCGTGG - Intergenic
1104906696 12:132217350-132217372 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906762 12:132217662-132217684 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906799 12:132217843-132217865 GTAGGTAGATGGATGGATAAAGG - Intronic
1105279828 13:18956988-18957010 ATGGGTAGATGGATGGATCATGG - Intergenic
1106986441 13:35357593-35357615 GCAGGGACATGGATGGAGCTGGG - Intronic
1107821649 13:44291310-44291332 GTAAATATATTGGTGGAGCATGG - Intergenic
1108092521 13:46864110-46864132 GCAGGGACATGGATGGAGCCTGG + Intronic
1108167401 13:47707901-47707923 GTAGGTAAAATGATGGAACAGGG - Intergenic
1108174559 13:47778728-47778750 GCAGGGATATGGATGAAGCTGGG - Intergenic
1108784656 13:53881553-53881575 GTAGGTATAGCCATGGAGCTTGG - Intergenic
1109556783 13:63986674-63986696 GTAGGGACATGGATGAAGCTAGG - Intergenic
1109666592 13:65547890-65547912 GCAGGAACATGGATGGAGCTGGG - Intergenic
1110628091 13:77674313-77674335 GCAGGGACATGGATGGAGCTGGG + Intergenic
1111771835 13:92606381-92606403 GTAGGGACATGGATGAAGCTGGG - Intronic
1112113298 13:96326471-96326493 GTAGGGACATGGATGAAGCTGGG - Intronic
1112609954 13:100946284-100946306 GTGGGGAACTGGATGGAGCAAGG - Intergenic
1116109911 14:40564793-40564815 GTAGGTACATGGATGAAGCTGGG - Intergenic
1116116227 14:40654467-40654489 ATAGGTAAATGGATGGAGAATGG + Intergenic
1116129055 14:40829729-40829751 GTAGGAACATGGATGGAGCCAGG + Intergenic
1116161928 14:41278428-41278450 GCAGGGACATGGATGAAGCATGG - Intergenic
1116496974 14:45572823-45572845 GCAGGTACATGGATGGAACTGGG - Intergenic
1118397425 14:65349288-65349310 GTGGGAATGTGGATGGAGCTTGG + Intergenic
1119188051 14:72658677-72658699 GTTGGTCTCTGGATGGAGCTAGG - Intronic
1119517167 14:75257416-75257438 GTAGGTCAGAGGATGGAGCAAGG + Intronic
1121816029 14:96929183-96929205 TTAGGTAGATGGATGGGGGATGG - Intronic
1122354997 14:101117653-101117675 GTAGATATATGGAAGGAAAATGG - Intergenic
1123397715 15:19954050-19954072 GTAGGGACATGGATGAAGCTGGG + Intergenic
1124812024 15:32950535-32950557 GCAGGCACATGGATGGAGCTGGG + Intronic
1125072879 15:35576718-35576740 GTAGCTATATGCCTGGAGCTAGG - Intergenic
1125175467 15:36817264-36817286 GTAGTCATATTGATGGATCAGGG + Intergenic
1127911869 15:63422921-63422943 ATAAGTAGATGGATGGAGGATGG + Intergenic
1128630283 15:69258291-69258313 GTAGAAATATGGATGGAGCGAGG - Intronic
1128983092 15:72200455-72200477 GTTGGTACGTGGCTGGAGCAGGG - Exonic
1132358492 15:101191870-101191892 GTAGATAGATGGATGAAGGAAGG - Intronic
1134075653 16:11289638-11289660 CTAAGTAAATGGATGGAGGATGG - Intronic
1134409549 16:13992661-13992683 GTCGTTTTATGGATGGAGCCAGG + Intergenic
1134518193 16:14903913-14903935 GGAGTCATATGGATGGACCATGG - Intronic
1134705864 16:16302571-16302593 GGAGTCATATGGATGGACCATGG - Intergenic
1134820015 16:17239416-17239438 GTAGATGGATGGATGGATCATGG - Intronic
1134827504 16:17296397-17296419 GTAGGTTTCTGGAAGGAGCAGGG - Intronic
1134961676 16:18409539-18409561 GGAGTCATATGGATGGACCATGG + Intergenic
1134965975 16:18492142-18492164 GGAGTCATATGGATGGACCATGG + Intronic
1135806893 16:25550853-25550875 GCAGGGACATGGATGGAGCTGGG + Intergenic
1136415417 16:30100243-30100265 GTAGGCATATGGATGAAGGAAGG - Intergenic
1136773679 16:32860296-32860318 GCAGGTCTATGGATGGGGCCGGG - Intergenic
1136896933 16:34001223-34001245 GCAGGTCTATGGATGGGGCCGGG + Intergenic
1138552440 16:57754998-57755020 GTATGTCCATGGAGGGAGCATGG + Intronic
1138580450 16:57937576-57937598 GTTGGTAAGTGGAGGGAGCATGG - Intronic
1138766179 16:59607554-59607576 GCAGGGACATGGATGGAGCTGGG - Intergenic
1138774356 16:59703674-59703696 GTGGGTTTATGGAGGGAGAAAGG - Intergenic
1139575643 16:67840439-67840461 GTGGGAATATGCATGGAGCTGGG + Intronic
1139850927 16:69951365-69951387 GGAGGTCTCTGGATGCAGCATGG - Exonic
1139879909 16:70174277-70174299 GGAGGTCTCTGGATGCAGCATGG - Exonic
1140372605 16:74421250-74421272 GGAGGTCTCTGGATGCAGCATGG + Exonic
1140710106 16:77669852-77669874 GTAGGAATTGGGATGGAGAAAGG - Intergenic
1140828149 16:78726581-78726603 GTAGGTAAATTAATGGAGGAAGG + Intronic
1141110200 16:81265689-81265711 GTAGGTAGATGGATGGTGGATGG - Intronic
1141421637 16:83921444-83921466 GTGGGTGGATGGATGGCGCAGGG + Exonic
1141505473 16:84475032-84475054 GCAGGAACATGGATGGAGCTGGG + Intergenic
1141534996 16:84673073-84673095 GTAGGTCTGTGGGTGGAGAATGG - Intergenic
1142152860 16:88520443-88520465 GTGGGTAGATGGATGGTGGATGG + Intronic
1203076097 16_KI270728v1_random:1122407-1122429 GCAGGTCTATGGATGGGGCCGGG - Intergenic
1142553287 17:753734-753756 GTAGGTATTTGGAAGGACGAGGG + Intronic
1142922770 17:3205602-3205624 GCAGGGACATGGATGGAGCTTGG + Intergenic
1142945707 17:3425174-3425196 GCAGGAACATGGATGGAGCTTGG - Intergenic
1144005800 17:11097823-11097845 GCAGCTATATGGATTGAGCCAGG - Intergenic
1147473789 17:40689941-40689963 GTAGGCACATGGATGAAGCTGGG - Intergenic
1149359125 17:55874628-55874650 GTAGGGATATGGATGAAGCTGGG - Intergenic
1149588412 17:57809402-57809424 ATGGGTATATGGATGGAGTTCGG - Intergenic
1150243211 17:63652661-63652683 GAAGGCAGATGGATGGGGCAGGG + Intronic
1151342905 17:73483067-73483089 GCAGGTATAGGGCAGGAGCACGG - Intronic
1151343551 17:73487296-73487318 GTAGCCTTATGGAAGGAGCAAGG + Intronic
1153351951 18:4090939-4090961 GCAGGGACATGGATGGAGCTGGG + Intronic
1154176497 18:12089334-12089356 GCAGGTCTATGGCTGGGGCAGGG - Intergenic
1157055194 18:44219770-44219792 GCAGGGATGTGGATGGAGCTGGG + Intergenic
1157961494 18:52158767-52158789 GTAGGGACATGGATGAAGCTGGG - Intergenic
1159685282 18:71411157-71411179 GTAGGGACATGGATGAAGCTGGG - Intergenic
1162531018 19:11236582-11236604 GTAGGGATGTGGAGTGAGCAGGG + Intronic
1163080285 19:14934912-14934934 GCAGGGACATGGATGGAGCTGGG - Intergenic
1163214501 19:15865874-15865896 GTAGGAACATGGATGGAGCTGGG + Intergenic
1163221007 19:15921169-15921191 GTAGATATTTGGATGCAGTAGGG - Intronic
1164110740 19:22155800-22155822 GTAGGGAAATGGATGAAGCTGGG - Intergenic
1164669747 19:30065645-30065667 GGAGGTATGTGGAGGGAGGAGGG + Intergenic
1164984708 19:32639854-32639876 GTAAGTGGATGGATGAAGCAAGG + Intronic
1168086896 19:54054769-54054791 GTAGGTAGATAGATGGATGAAGG + Intronic
1168330950 19:55568188-55568210 GTAGATAGATGGATGGATGATGG + Intergenic
928285191 2:29984141-29984163 GCAGGAACATGGATGGAGCAGGG - Intergenic
928807795 2:35182230-35182252 GTAGGAACATGGATGAAGCTGGG - Intergenic
929337611 2:40769248-40769270 GTAGGTAAGTGGATGGGGAAGGG - Intergenic
933037002 2:77412182-77412204 GTAGGTAAGTGGATTGAACAAGG + Intronic
935081748 2:99804778-99804800 GTAGCAATGTGGATGGAGCTGGG + Intronic
935961067 2:108426045-108426067 GCAGGGAGATGGATGGAGCAGGG + Intergenic
939532867 2:143386851-143386873 GTGGGAACATGGATGGAGCTGGG + Intronic
940264433 2:151821504-151821526 GTAGGTGTTTGGGTGGAGTAAGG - Intronic
940462880 2:153989611-153989633 AAAGGTATATGGGTGTAGCAAGG + Intronic
940632937 2:156261509-156261531 GCAGGGACATGGATGGAGCTGGG + Intergenic
940887184 2:159000184-159000206 GTGGGTAAGTGGATGGAGCGTGG + Intronic
941418972 2:165258780-165258802 GCAGGGACATGGATGGAGCTGGG + Intronic
941878887 2:170461822-170461844 GTATGTATATGTATGGAGGTCGG + Intronic
943192629 2:184699029-184699051 ATAGTTATATGCATGGTGCATGG + Intronic
947083142 2:226421023-226421045 GTAGGTTCATGGATGGACCTTGG - Intergenic
947382408 2:229558074-229558096 GCAGGGACATGGATGGAGCTGGG + Intronic
948043480 2:234924009-234924031 GTGGGAACATGGATGGAGCTTGG - Intergenic
1172015203 20:31869354-31869376 GAAGGGACATGGAGGGAGCATGG - Intronic
1172230814 20:33334342-33334364 GTGGGTAGATGGATGGTGGATGG + Intergenic
1174089476 20:48035588-48035610 GGAGGTATCTGTATGCAGCAAGG + Intergenic
1174240091 20:49126843-49126865 CTAGGTATCTGCATGGAGCGGGG + Intronic
1174940919 20:54926168-54926190 TTAGGTAAATGGATGGTGGATGG - Intergenic
1175668443 20:60880223-60880245 GCAGGAACATGGATGGAGCTGGG + Intergenic
1177518634 21:22188091-22188113 GGAGGTATATGCAGAGAGCAAGG - Intergenic
1179040620 21:37799216-37799238 GCAGGAACATGGATGGAGCTGGG - Intronic
1179598343 21:42458606-42458628 GTGGCTATGTGGAAGGAGCATGG - Intergenic
1179899449 21:44381415-44381437 GTAGATAGATGGATGGATGATGG + Intronic
1182717166 22:32366493-32366515 GCAGGAACATGGATGGAGCTGGG + Intronic
1182941156 22:34278785-34278807 GTAGGTATATGGAGAGAGCAAGG - Intergenic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
949421264 3:3868567-3868589 GTAGGAACATGGATGAAGCTGGG + Intronic
950974625 3:17227545-17227567 GTAGGAACATAGATGGAGCTGGG + Intronic
955467267 3:59250345-59250367 GTAGGTATATGCATGGGAGAGGG - Intergenic
955800474 3:62681044-62681066 GAAGGGAAATGCATGGAGCAGGG - Intronic
956313748 3:67911549-67911571 GTAGGGACATGGATGAAGCTGGG + Intergenic
957948303 3:87092543-87092565 GTAGGGATGTGGATGAAGCTGGG - Intergenic
958100322 3:89000047-89000069 GTAGGAACATGGATGGATTAGGG + Intergenic
959126439 3:102295059-102295081 GTTGTTGTATGGAGGGAGCAGGG + Intronic
960151602 3:114254317-114254339 GTAGTTTTGTGGATGAAGCAAGG - Intergenic
960294622 3:115927865-115927887 CGAGGTATGTGGCTGGAGCAAGG - Intronic
961577375 3:127848926-127848948 GTGGGTATCTGGGTGGAGCGTGG + Intergenic
963278112 3:143353138-143353160 GTAGGAATCTGTAAGGAGCAGGG - Intronic
964037001 3:152211194-152211216 ATAGGTATATGGATGGTGGGTGG + Intergenic
964834199 3:160919498-160919520 GTAGGCTGATGGATGGAGGAAGG + Intronic
964912385 3:161799116-161799138 GTAGGGACATGGATGAAGCTGGG + Intergenic
965365685 3:167796651-167796673 GCAGGGACATGGATGGAGCTGGG - Intronic
966111821 3:176412114-176412136 GTAGGAAGATTGAGGGAGCATGG - Intergenic
969256760 4:6007700-6007722 ATAGGTAGATGGATGGATGATGG + Intergenic
970784581 4:19780591-19780613 GATGGGAAATGGATGGAGCAGGG + Intergenic
970796164 4:19915968-19915990 GTAGGGACATGGATGAAGCCAGG - Intergenic
971568542 4:28178644-28178666 GTAGGGACATGGATGAAGCTGGG + Intergenic
972117685 4:35657710-35657732 GCAGGGACATGGATGGAGCCGGG - Intergenic
972956713 4:44401210-44401232 GTAGGCATATGGGTGCAGAAGGG + Intronic
973324797 4:48848992-48849014 GTAGGGACATGGATGAAGCTGGG + Intronic
974481385 4:62448213-62448235 GTAGGGACATGGATGAAGCTGGG + Intergenic
974629159 4:64460719-64460741 GTAGGGACATGGATGGAGTAGGG - Intergenic
975194255 4:71505024-71505046 GCAGGGACATGGATGGAGCTAGG - Intronic
975891358 4:79032601-79032623 GTAGGTTTATGAATGGAGATTGG + Intergenic
976212069 4:82681483-82681505 GCAGGGACATGGATGGAGCTGGG + Intronic
977368058 4:96098370-96098392 GAAGGTATATGGATGAAACAAGG - Intergenic
978064479 4:104379379-104379401 GTAGGGACATGGATGAAGCTGGG + Intergenic
978288848 4:107112918-107112940 TTAGGTAAATGGATGGTGGATGG + Intronic
978489332 4:109294924-109294946 TTAGGTCTAGGGATGGAGAAGGG - Intronic
978771701 4:112463716-112463738 GCAGCTACATGGATGGAGCTGGG + Intergenic
978889468 4:113806024-113806046 GCAAATATATGGATGGGGCATGG + Intergenic
979600887 4:122585759-122585781 CTAGATGGATGGATGGAGCATGG + Intergenic
980288536 4:130813282-130813304 GTAGGGACATGGATGAAACATGG + Intergenic
981799656 4:148640641-148640663 GCAGGTAGAAGCATGGAGCATGG + Intergenic
981805846 4:148713955-148713977 GTAAATTTAGGGATGGAGCATGG + Intergenic
982961984 4:161850865-161850887 GCAGGGACATGGATGGAGCTGGG + Intronic
982962089 4:161852808-161852830 GCAGGGACATGGATGGAGCTGGG + Intronic
983476073 4:168213314-168213336 GTAGGGATATGAATGAAGCTGGG - Intergenic
983695712 4:170527547-170527569 GTAGCTATAAGGATGAAACACGG - Intergenic
983708400 4:170686463-170686485 GTAGGGACATGGATGAAGCTGGG - Intergenic
985006509 4:185539943-185539965 GAGGGGATAGGGATGGAGCAAGG + Intergenic
986161502 5:5233636-5233658 GCAGGAACATGGATGGAGCCTGG - Intronic
986849962 5:11799646-11799668 GTAGCGATATGGACAGAGCAAGG - Intronic
987470963 5:18326885-18326907 TTAGGTATATGGATGGTCAATGG + Intergenic
987878923 5:23715925-23715947 TTAGATAGATGGAAGGAGCAGGG + Intergenic
988645345 5:33089329-33089351 GTAGCAACATGGATGGAGCTGGG - Intergenic
989069359 5:37494427-37494449 CTAGGTATTTGGATGGACTACGG + Intronic
990509236 5:56475283-56475305 GTAGGGACATGGATGAAGCTGGG - Intronic
995189491 5:109305531-109305553 GTAGGTGCATGGAAGGAACAGGG - Intergenic
996004235 5:118401946-118401968 GCAGGGACATGGATGGAGCTAGG - Intergenic
996424695 5:123301636-123301658 GCAGGGACATGGATGGAGCTGGG + Intergenic
997749112 5:136327577-136327599 GAAGGTATGAGGATGGAGGAAGG + Intronic
997944888 5:138191352-138191374 ATAGGTGTAGGGATGTAGCAGGG - Intronic
998549486 5:143063663-143063685 AAAGGTAAAAGGATGGAGCAGGG - Intronic
999746606 5:154597060-154597082 GTAGGTTGATGGATGGCACATGG - Intergenic
1000161856 5:158605476-158605498 GCAGGAACATGGATGGAGCTGGG - Intergenic
1002176017 5:177401801-177401823 GTATGTCTAGGGATGGGGCATGG - Intergenic
1002643015 5:180639539-180639561 GTGGGCATATGGGTGAAGCATGG + Intronic
1002874587 6:1200093-1200115 GGAGGTATATTCATGAAGCAGGG - Intergenic
1003238075 6:4316511-4316533 GAAGGTTTCTGGATGGAGCCTGG + Intergenic
1005089148 6:22038125-22038147 CTAAGTATATGGATGGTGGATGG + Intergenic
1005436117 6:25813879-25813901 GCAGGGAAATGGATGGAGCTGGG - Intronic
1005574939 6:27181877-27181899 GTAGGCATATGGATGAAGGCAGG - Intergenic
1005745329 6:28831926-28831948 GTAGGGACATGGATGAAGCTGGG + Intergenic
1005796345 6:29366001-29366023 GTAGGGACATGGATGAAGCTGGG + Intronic
1007603555 6:43099563-43099585 CTAGGGATATAGATAGAGCAGGG + Intronic
1008634842 6:53400344-53400366 GTAGGGACATGGATGAAGCTGGG - Intergenic
1009279503 6:61729174-61729196 GTAGGCACATGGATGGAGCTGGG + Intronic
1010195474 6:73235490-73235512 GTAGGGACATGGATGAAGCTGGG - Intronic
1010728353 6:79361234-79361256 GTAGGGACATGGATGAAGCTGGG - Intergenic
1011402354 6:86977330-86977352 GTAGCAACATGGATGGAGCTGGG - Intronic
1011907978 6:92396364-92396386 GTAAGTAAATGGATGGAAGATGG - Intergenic
1011938800 6:92816607-92816629 GTAGGAACATGGATGTAGCTGGG + Intergenic
1012166141 6:95955062-95955084 GCAGGGACATGGATGGAGCTGGG + Intergenic
1013753221 6:113431271-113431293 GTAGGTATTTTTGTGGAGCAAGG - Intergenic
1014501004 6:122189300-122189322 GCAGGGACATGGATGGAGCTGGG - Intergenic
1014777029 6:125522932-125522954 GCAGGAACATGGATGGAGCTGGG - Intergenic
1015694867 6:135968983-135969005 GCAGGGACATGGATGGAGCTGGG + Intronic
1015892666 6:137984085-137984107 GTAGGGACATGGATGAAGCTGGG - Intergenic
1018561239 6:165102759-165102781 GTGTGTAGATGGATGGAACATGG - Intergenic
1019089101 6:169510478-169510500 GTAGGGACATGGATGAAGCTGGG + Intronic
1021362509 7:19733518-19733540 GAAGGTCTAGGGAAGGAGCAGGG - Intronic
1021773930 7:24032973-24032995 GTAGGAACATAGATGGAGCTGGG - Intergenic
1023874990 7:44282027-44282049 GTAGGTGCATGTGTGGAGCATGG - Intronic
1024015098 7:45306436-45306458 GTAGTTATGTGGGTGGACCAGGG + Intergenic
1026828586 7:73598224-73598246 GTAGGTGAATGGATGGAAGACGG - Intronic
1027934918 7:84589729-84589751 GTATGTCTATGCATGGAGCTGGG - Intergenic
1028046143 7:86121539-86121561 GCAGGAACATGGATGGAGCTGGG + Intergenic
1028271111 7:88790567-88790589 GCAGGGACATGGATGGAGAAGGG - Intronic
1028912701 7:96225946-96225968 GTAGATATGGGGATGGAGGAGGG - Intronic
1029797074 7:102907614-102907636 GTAGGGACATGGATGAAGCTGGG - Intronic
1029877707 7:103771421-103771443 TTAGGGAGATGGGTGGAGCATGG - Intronic
1030147481 7:106371299-106371321 GTATGGATATGTGTGGAGCATGG - Intergenic
1031479277 7:122258545-122258567 GTAGGGACATGGATGAAGCTGGG - Intergenic
1031627458 7:124007234-124007256 GTAGGTGAATGAATTGAGCATGG + Intergenic
1034307632 7:150058364-150058386 GAAGGGATATGGGTGCAGCACGG - Intergenic
1034799218 7:154042305-154042327 GAAGGGATATGGGTGCAGCACGG + Intronic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035965831 8:4190795-4190817 GCAGGGACATGGATGGAGCTGGG + Intronic
1036113941 8:5937347-5937369 GCAGATACATGGATGGAGCTGGG - Intergenic
1040712355 8:50204863-50204885 GTAGGGACATGGATGAAGCTGGG - Intronic
1041653065 8:60320320-60320342 GTAAGAATGTGAATGGAGCAAGG + Intergenic
1042059384 8:64800273-64800295 GCAGGAACATGGATGGAGCTGGG + Intergenic
1043540598 8:81258012-81258034 GTAGGAACATGCCTGGAGCATGG + Intergenic
1044557912 8:93584698-93584720 GCAGGGACATGGATGGAGCAGGG + Intergenic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1045113273 8:98953489-98953511 GTAGGGGTAGGGATGGAGTATGG + Intergenic
1045582032 8:103492532-103492554 ATAGGAACATGGATGGAGCTGGG + Intergenic
1046615255 8:116470410-116470432 GTAGGTTTATTGATGGAAAACGG - Intergenic
1048781068 8:138001674-138001696 GAAGGTGTAGGGATGGAGAAGGG + Intergenic
1048816071 8:138334687-138334709 GCAGGGACATGGATGGAGCTGGG - Intronic
1049474794 8:142791872-142791894 GTGGGTGGATGGATGGAGGATGG - Intergenic
1049474899 8:142792572-142792594 GTGGGTGGATGGATGGAGGATGG - Intergenic
1050434619 9:5596174-5596196 GTAGGTATTTTGAGGGAGGAGGG - Intergenic
1050617121 9:7413360-7413382 GCAGGAATATGGATGAAGCCTGG + Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1055237573 9:74142610-74142632 GTAGGGACATGGATGAAGCTGGG + Intergenic
1055955870 9:81773060-81773082 GTTGGTAGAGGGATGAAGCAGGG + Intergenic
1056236663 9:84601317-84601339 GAAGATATAAGGGTGGAGCAAGG + Intergenic
1056819722 9:89830335-89830357 CTAAGTAAATGGATGGAGGATGG - Intergenic
1057731419 9:97612156-97612178 GCAGGGACATGGATGGAGCTGGG - Intronic
1057829475 9:98395778-98395800 GTGGTTAGAAGGATGGAGCAAGG + Intronic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059252171 9:112895582-112895604 GTAGATAGATGGATGGATGATGG - Intergenic
1059778901 9:117506209-117506231 GTAGGGACATGGATGAAGCTGGG + Intergenic
1060321670 9:122567608-122567630 GTAGATAAAAGGATTGAGCATGG + Exonic
1061062353 9:128257000-128257022 GTAGGGATATGGTGGGGGCAGGG + Exonic
1185867944 X:3639492-3639514 GTGGGTACATGGATGGATGAAGG + Intronic
1186535028 X:10338185-10338207 GTAGGGACATGGATGAAGCTGGG - Intergenic
1187184922 X:16975010-16975032 GCAGGAACATGGATGGAGCTGGG - Intronic
1188966568 X:36560846-36560868 GTAGGAATGTGGATGGAGGTGGG - Intergenic
1191157728 X:57293839-57293861 GTGGGTAAATGGGGGGAGCATGG + Intronic
1191203070 X:57805329-57805351 GTAGGGACATGGATGAAGCTGGG - Intergenic
1191595638 X:62941045-62941067 GCAGGGATATGGATGAAGCTGGG + Intergenic
1191749272 X:64523813-64523835 GTAGGGACATGGATGAAGCTGGG + Intergenic
1191939219 X:66459679-66459701 GTAGGGACATGGATGAAGCTGGG + Intergenic
1192300075 X:69891609-69891631 GCAGGGACATGGATGGAGCTGGG + Intronic
1193024966 X:76836974-76836996 GCAGGAACATGGATGGAGCCCGG + Intergenic
1193731231 X:85106531-85106553 GTAAATATGTGGCTGGAGCAAGG - Intronic
1193733986 X:85135021-85135043 GCAGGGACATGGATGGAGCTGGG + Intergenic
1193799454 X:85917140-85917162 GCAGGGACATGGATGGAGCTGGG + Intronic
1194727498 X:97415550-97415572 GTAGGGACATGGATGAAGCTGGG + Intronic
1195343417 X:103926302-103926324 GTGGGAAAATGGATGGAGCAGGG + Intronic
1195343426 X:103926341-103926363 GTGGGGATATGGATGGAGTGGGG + Intronic
1195343434 X:103926382-103926404 GTGAGGATATGGATGGAGCAGGG + Intronic
1195343452 X:103926459-103926481 GTAGGGATATGGATGTAGTGGGG + Intronic
1195343462 X:103926498-103926520 GAGGGGATATGGATGGAGCAGGG + Intronic
1195343475 X:103926537-103926559 GTGGGGATATGGATGGAGCAGGG + Intronic
1195363493 X:104106782-104106804 GTGGGGAGATGGATGGAGCAGGG - Intronic
1195363536 X:104106969-104106991 GTGGGGATATGGATGGAGCAGGG - Intronic
1195363544 X:104107008-104107030 GTGGGGATATGGATGGGGCAGGG - Intronic
1195363556 X:104107047-104107069 TGTGGGATATGGATGGAGCAGGG - Intronic
1195363563 X:104107085-104107107 GTGGGGATGTGGATGGAGCAGGG - Intronic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1195365036 X:104116914-104116936 GTAGGTATATGGATGGAGCAGGG - Intronic
1195365049 X:104116993-104117015 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365061 X:104117033-104117055 GTGGGGATGTGCATGGAGCAGGG - Intronic
1195365073 X:104117111-104117133 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365093 X:104117191-104117213 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365103 X:104117231-104117253 GCGGGGATATGGATGAAGCAGGG - Intronic
1195576782 X:106460515-106460537 GTAGCTGTATGCAAGGAGCAGGG - Intergenic
1196468385 X:115995637-115995659 GTAGGGACATGGATGGGGCTGGG - Intergenic
1197552474 X:127910084-127910106 GTATGAACATGGATGGAGCTGGG + Intergenic
1199156729 X:144557865-144557887 GCAGGAATATGGATGAAGCTAGG - Intergenic
1200255316 X:154578899-154578921 GTGGGAAGATGGATTGAGCATGG + Intergenic
1200262453 X:154625505-154625527 GTGGGAAGATGGATTGAGCATGG - Intergenic
1201736422 Y:17267595-17267617 GTAGGAACATGGATGGAGCTGGG + Intergenic
1201908470 Y:19108664-19108686 GTAGGGACATGGATGAAGCCAGG - Intergenic