ID: 1195367692

View in Genome Browser
Species Human (GRCh38)
Location X:104141873-104141895
Sequence AGTCCTAGGACTGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 778
Summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 697}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195367692_1195367698 4 Left 1195367692 X:104141873-104141895 CCACCACACCCAGTCCTAGGACT 0: 1
1: 0
2: 4
3: 76
4: 697
Right 1195367698 X:104141900-104141922 TTCTTACCTACAGATAGAATAGG 0: 1
1: 1
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195367692 Original CRISPR AGTCCTAGGACTGGGTGTGG TGG (reversed) Intronic
900133418 1:1101782-1101804 AGTTTTAGGGCTGGGTGTGGTGG + Intronic
900567966 1:3344047-3344069 CATCCTTGGGCTGGGTGTGGTGG + Intronic
901474837 1:9482314-9482336 TGTTCTGGGACTGGGTGTGGTGG + Intergenic
902367327 1:15985308-15985330 AGACCCAGGCCTGGGTGTGGTGG - Intergenic
903585122 1:24409078-24409100 GCCCCTAGGGCTGGGTGTGGTGG + Intronic
903722766 1:25418313-25418335 AGAGCAGGGACTGGGTGTGGTGG - Intronic
904707391 1:32401635-32401657 AGTTATAGAGCTGGGTGTGGTGG + Intergenic
905128096 1:35730254-35730276 AAACCTAAGGCTGGGTGTGGTGG + Intronic
905696789 1:39980574-39980596 AGGTTTAGGACTGGGTGTGTTGG + Intergenic
905969517 1:42130914-42130936 TTTCTTAGGGCTGGGTGTGGTGG + Intergenic
905978680 1:42202821-42202843 AATATTTGGACTGGGTGTGGTGG - Intronic
906231322 1:44167021-44167043 ATACATAGGGCTGGGTGTGGTGG - Intergenic
906331539 1:44889246-44889268 AGTCCTATGGCTAGGAGTGGTGG + Intronic
906488269 1:46247966-46247988 AGTCCGAGGCCCGGGTGGGGAGG - Exonic
906566388 1:46804133-46804155 AGGCCAAGGACTGGATCTGGAGG + Intronic
906619182 1:47260583-47260605 AATGTTAGGGCTGGGTGTGGTGG + Intronic
906784194 1:48599938-48599960 GGTCCTGGGACTGAGTCTGGAGG + Intronic
907325958 1:53638729-53638751 ACTCCTTGTTCTGGGTGTGGGGG - Intronic
907502217 1:54889249-54889271 AGTACTCAGGCTGGGTGTGGTGG + Intergenic
908030510 1:59994311-59994333 TGTCATGGGACTGGGTGTAGTGG + Intronic
909713618 1:78680339-78680361 AGTCCCTGGACTGTGAGTGGGGG - Intergenic
910496441 1:87834367-87834389 AGTCTTCTGGCTGGGTGTGGTGG + Intergenic
910675825 1:89815687-89815709 ATTCATAGGGCTGGGTGTGGTGG - Intronic
910888930 1:91996532-91996554 AAACCTGGGGCTGGGTGTGGTGG - Intronic
911356221 1:96824010-96824032 ATTCTCATGACTGGGTGTGGTGG - Intergenic
911721948 1:101200708-101200730 AGGCCTAGGCCTGGGTGCTGAGG - Intergenic
912328429 1:108792868-108792890 AGTCCCAGGACTGAATGTGTAGG + Intronic
912512012 1:110195932-110195954 AGTCTGAGGACTGGGTGTCCTGG + Intronic
912522749 1:110257426-110257448 AGTCCAGGGACCGGGTGCGGTGG + Intronic
912533224 1:110341170-110341192 CGTTCTCGGACTGGGGGTGGGGG - Exonic
912910212 1:113750972-113750994 AATTTTAGGGCTGGGTGTGGTGG + Intronic
913001966 1:114589643-114589665 AGTGTTGGGGCTGGGTGTGGTGG - Intronic
913265780 1:117042381-117042403 AGTGTTAAGGCTGGGTGTGGTGG - Intergenic
913280274 1:117178875-117178897 ATTCATAAGGCTGGGTGTGGTGG - Intronic
914747582 1:150511268-150511290 AGCACTAGGCCTGGGTCTGGAGG + Intronic
914851107 1:151314901-151314923 AGTCTCAGGTCAGGGTGTGGAGG + Intronic
915243820 1:154542513-154542535 CATCCTAGGGCTGGGTATGGTGG - Intronic
915645843 1:157271661-157271683 AGTTCTAGCAGAGGGTGTGGAGG - Intergenic
916029045 1:160860997-160861019 AGCCCTGGGAATGGGGGTGGAGG + Intronic
916340993 1:163734810-163734832 AGACCCAGGACTGGGTGCAGTGG - Intergenic
916568443 1:166003977-166003999 TGGCCTCGGGCTGGGTGTGGTGG + Intergenic
916897179 1:169177497-169177519 AATTCTTGGGCTGGGTGTGGTGG + Intronic
918263552 1:182819031-182819053 AGTCATTGGACTGGGCATGGTGG + Intronic
920054535 1:203182652-203182674 AGTGCTAGGGCTGGGGGTGGCGG + Intronic
920762846 1:208802345-208802367 AGGCATGGGGCTGGGTGTGGTGG - Intergenic
920942697 1:210499053-210499075 ACTGCAAGGGCTGGGTGTGGTGG - Intronic
921135137 1:212253299-212253321 AGTTAAAGGGCTGGGTGTGGTGG + Intergenic
921703693 1:218295295-218295317 AGTCTTGGGACAGGGTGCGGGGG + Intronic
921865349 1:220082466-220082488 AGTCCCAGGGCTGAGCGTGGTGG - Intronic
922038358 1:221871702-221871724 AATTATTGGACTGGGTGTGGTGG - Intergenic
922809825 1:228409218-228409240 AGTCCTGGGTCTGGTTGGGGGGG + Exonic
922910450 1:229211285-229211307 AGTCTTGGGACTGGGTGTGGTGG + Intergenic
923756889 1:236799408-236799430 ATTACTTGGGCTGGGTGTGGTGG - Intronic
924057054 1:240134328-240134350 AACACTTGGACTGGGTGTGGTGG + Intronic
924119486 1:240781725-240781747 AGATCTTGGGCTGGGTGTGGTGG + Intronic
924447650 1:244148847-244148869 AGTACAAGGGCTGGGCGTGGTGG + Intergenic
924513029 1:244743461-244743483 AATCATAGGGCTGGGTGCGGTGG - Intergenic
924699748 1:246439247-246439269 AATATTTGGACTGGGTGTGGTGG - Intronic
924725377 1:246664711-246664733 AGTGTTAAGGCTGGGTGTGGTGG - Intronic
1063568432 10:7192885-7192907 GGTCCAAAGACTGGGTGTGAAGG - Intronic
1064337759 10:14458990-14459012 GGTCCTGGGCCTGGATGTGGAGG + Intronic
1064421422 10:15194104-15194126 AGTCCTAGCAATAAGTGTGGTGG - Intergenic
1065762656 10:28996915-28996937 CATCCCAGGGCTGGGTGTGGTGG - Intergenic
1066420349 10:35259474-35259496 ACAACCAGGACTGGGTGTGGTGG - Intronic
1066692786 10:38047340-38047362 AGCCCTTGGGCTGGGTGTGGTGG + Intronic
1067059307 10:43069775-43069797 AGTCCTGGGGCTGGGCCTGGAGG + Intergenic
1068108484 10:52650449-52650471 AATCCTAGGCCTGGGAGGGGTGG + Intergenic
1068707241 10:60090717-60090739 AATCCAAGAAGTGGGTGTGGAGG - Intronic
1069017665 10:63448442-63448464 TGTATTAGGGCTGGGTGTGGAGG - Intronic
1069055072 10:63836366-63836388 AGTACCAGGAGTGGGTGTGGCGG + Intergenic
1069775687 10:70925891-70925913 AGCCCTGGGACTGGGTCAGGGGG + Intergenic
1069983534 10:72268751-72268773 AGAAGTAGGGCTGGGTGTGGTGG - Intergenic
1070074137 10:73118686-73118708 AATACTATGGCTGGGTGTGGTGG + Intronic
1070096593 10:73343419-73343441 GGACCTGGGGCTGGGTGTGGTGG + Intronic
1070223927 10:74480564-74480586 AGGCTAGGGACTGGGTGTGGTGG - Intronic
1070382146 10:75890815-75890837 TGGCCTATGGCTGGGTGTGGTGG + Intronic
1070434562 10:76377170-76377192 AGACATACGGCTGGGTGTGGTGG - Intronic
1070826378 10:79392594-79392616 AGCCCTTGGGCTGGGTGTTGTGG - Intronic
1070902415 10:80042101-80042123 AGAACCAGGACTGGGCGTGGTGG + Intergenic
1071186619 10:83053789-83053811 ATTCCTAGGGCTGGGAGCGGTGG - Intergenic
1071200433 10:83215998-83216020 TGTTCTAGGGTTGGGTGTGGTGG - Intergenic
1071278420 10:84077328-84077350 GGTCCAGGGGCTGGGTGTGGTGG + Intergenic
1071371077 10:84952423-84952445 AGTGCTAGGTGTGGGTGGGGAGG + Intergenic
1071599298 10:86949586-86949608 AGTCTTGGGGCTGGGTGTGGTGG + Intronic
1071706753 10:88007639-88007661 AGTTCTAGGGCCAGGTGTGGTGG + Intergenic
1072090885 10:92126009-92126031 AGTTCTAGGGCCAGGTGTGGTGG - Intronic
1073003415 10:100302441-100302463 AATCCTAGCACTGTGGGTGGTGG + Intronic
1073112402 10:101070399-101070421 AGTCCTAGAAATGTGTGTGTTGG - Intergenic
1073537300 10:104289381-104289403 ATTTGTAGGGCTGGGTGTGGTGG - Intronic
1074713040 10:116193262-116193284 AGCCCCTGGAGTGGGTGTGGAGG - Intronic
1075269646 10:121037610-121037632 AGTGATAGGGCTGGGCGTGGTGG + Intergenic
1075332264 10:121582215-121582237 AGGGCTAGGACTGGGTGCAGTGG - Intronic
1075384567 10:122046185-122046207 AATAATAGGGCTGGGTGTGGTGG + Intronic
1075629158 10:123990458-123990480 AATCCCTGGGCTGGGTGTGGTGG - Intergenic
1076391965 10:130110276-130110298 AGGCCCAGGGCTGGGTGTTGGGG - Intergenic
1076779227 10:132714801-132714823 AGCCCTGTGACTGGCTGTGGTGG - Intronic
1077299576 11:1840800-1840822 GCTCCTAGGGGTGGGTGTGGGGG - Exonic
1077406135 11:2383342-2383364 AGTGCCAGGCCTGGGTGTGGAGG - Intronic
1078272956 11:9813611-9813633 AGAAGTAGGACTGGGCGTGGTGG - Intronic
1078277577 11:9864829-9864851 AGTCCTTTGCCTGGGTTTGGTGG + Intronic
1078719945 11:13875184-13875206 TGTCCTAGGTCTGGTTGTGAAGG - Intergenic
1081441994 11:43090893-43090915 ATTCCTAGAACTGGGTGGGGAGG + Intergenic
1081978771 11:47253254-47253276 AGGTATAAGACTGGGTGTGGTGG - Intronic
1083158112 11:60838002-60838024 AGTCCTAGGCCTGGTGGAGGTGG + Intergenic
1083246909 11:61435833-61435855 AATGTTACGACTGGGTGTGGTGG + Intronic
1083278629 11:61611662-61611684 AGTCCTCTGGCTGGGGGTGGGGG - Intergenic
1083334738 11:61916056-61916078 AGTCTTAGGGCAGGGCGTGGTGG + Intronic
1083557990 11:63647478-63647500 ACTTTTAAGACTGGGTGTGGTGG - Intronic
1083780648 11:64915689-64915711 AAGCCTAGGGCTGGGTATGGTGG + Intronic
1083827208 11:65210576-65210598 AGGCCTGGGTCTGGGTTTGGGGG + Intronic
1083919356 11:65773514-65773536 AGTGCTTGGACCGGGTGCGGTGG + Intergenic
1084080843 11:66823531-66823553 AGAGCTAGGGCTGGGTGTGGTGG + Intronic
1084294216 11:68200208-68200230 AGTCCAAGGACTGGGTGTCGGGG + Intronic
1084963366 11:72729628-72729650 CATCCTAGGGCTGGGTATGGTGG + Intronic
1085006318 11:73093921-73093943 AAAGATAGGACTGGGTGTGGTGG + Intronic
1085122988 11:73979257-73979279 ACTTCTTGGGCTGGGTGTGGTGG + Intronic
1085398987 11:76224350-76224372 AGGCCTAGGGTTGGGGGTGGGGG + Intergenic
1085550634 11:77367689-77367711 AGATCTAGGGCTGGGCGTGGTGG + Intronic
1085735989 11:79039503-79039525 TGTCATAGGACTGAGTGTGTTGG + Intronic
1085995978 11:81914418-81914440 AGTCCTTGGGCCGGGCGTGGTGG - Intergenic
1086091617 11:83010161-83010183 AATACTTGGACTGGGCGTGGTGG + Intronic
1086493969 11:87383919-87383941 TGTAGTAGGGCTGGGTGTGGTGG - Intergenic
1087475960 11:98634648-98634670 AATACTTGGGCTGGGTGTGGTGG - Intergenic
1087666590 11:101056350-101056372 TGGCCTGGGGCTGGGTGTGGTGG + Intronic
1087736578 11:101840976-101840998 AGGCCAAGGACCCGGTGTGGTGG - Intronic
1088121168 11:106371870-106371892 AGTCTTGGGCCTGGGAGTGGTGG + Intergenic
1088121275 11:106373360-106373382 AGTCCTAGGGCCGGGTGCAGTGG - Intergenic
1088798226 11:113282659-113282681 AGTGCTAGAACTGGGGCTGGAGG - Intergenic
1089577033 11:119452124-119452146 AGACCAAAGGCTGGGTGTGGTGG + Intergenic
1089734841 11:120543288-120543310 AAAACTAGGCCTGGGTGTGGTGG + Intronic
1089743508 11:120601116-120601138 GGTCCAGGGGCTGGGTGTGGTGG + Intronic
1089872890 11:121692603-121692625 AATCATAGGAGTGGGGGTGGGGG - Intergenic
1090077492 11:123588351-123588373 AGCCCTTGGCATGGGTGTGGGGG + Intronic
1090155816 11:124437708-124437730 AGTCCTGAGGCTGGGTGCGGTGG - Intergenic
1090754274 11:129775003-129775025 AAACAGAGGACTGGGTGTGGTGG - Intergenic
1091491738 12:938393-938415 AGGCTTAAGGCTGGGTGTGGTGG + Intronic
1091722227 12:2821603-2821625 AATGCTAGGATGGGGTGTGGGGG + Intronic
1092624805 12:10315828-10315850 AGGATTTGGACTGGGTGTGGTGG + Intergenic
1093517280 12:20003683-20003705 AGTCCATTGGCTGGGTGTGGTGG + Intergenic
1093598234 12:20987744-20987766 AATTCAAGTACTGGGTGTGGTGG - Intergenic
1093932323 12:24966714-24966736 AGTCCTGAGGCTGGGCGTGGTGG + Intergenic
1094044864 12:26156345-26156367 AGTGCTAAGCCTGGGTGTGAGGG + Intronic
1094136170 12:27128885-27128907 TGTCCTCTCACTGGGTGTGGTGG - Intergenic
1094185740 12:27640630-27640652 TGTCCTCTCACTGGGTGTGGTGG - Intronic
1095164887 12:38960312-38960334 AGTTCTAAGACTGAGTGTTGAGG + Intergenic
1095582404 12:43815030-43815052 AAACCCAGGGCTGGGTGTGGTGG - Intergenic
1095799314 12:46255874-46255896 AGTCAAAGGGCTGGGTGTGGTGG + Intronic
1095966334 12:47869601-47869623 AGTACTGGGACTGGGTGCAGTGG + Intronic
1096138927 12:49226134-49226156 AGTCCTTTGACTGGGCGTGGGGG + Intronic
1096332899 12:50730008-50730030 AGGAATGGGACTGGGTGTGGTGG - Intronic
1096355243 12:50935774-50935796 AATTCTGGGGCTGGGTGTGGTGG - Intergenic
1096377120 12:51121751-51121773 AATCATTGGGCTGGGTGTGGTGG - Intronic
1096482502 12:51951838-51951860 AGTCCTGGGACGGGGGGCGGGGG + Intronic
1096678141 12:53236667-53236689 AGTCCCAGGTGTGGGTGTGGGGG - Intergenic
1096678712 12:53240977-53240999 AGTCCCAGGTGTGAGTGTGGGGG - Intergenic
1096713017 12:53471548-53471570 AGTCGTAGGATTTGGGGTGGGGG + Intronic
1097125628 12:56772405-56772427 AGTGTTATGGCTGGGTGTGGTGG + Intronic
1097276809 12:57819329-57819351 ATTCCCAGGGCTGGGTGTGGTGG + Intergenic
1097277656 12:57824184-57824206 AGAACCAGGAGTGGGTGTGGTGG - Intronic
1097849262 12:64395259-64395281 AGGTTTAGGGCTGGGTGTGGCGG - Intergenic
1098047780 12:66419806-66419828 ATTTCTTGGGCTGGGTGTGGCGG + Intronic
1100380653 12:94058654-94058676 TTCCCTAGGACTGGGTGTGGTGG - Intergenic
1101091303 12:101288744-101288766 AGTCCTAGGACTGGTGGTACTGG - Intronic
1101587789 12:106100155-106100177 AATACTAGGGCTGGGTGTGGTGG - Intronic
1102449971 12:113034447-113034469 GGTGCTAAGACTGAGTGTGGTGG + Intergenic
1102686393 12:114728145-114728167 AGTCATGGGACTGGGCATGGTGG + Intergenic
1102882068 12:116493168-116493190 AGTCTAGAGACTGGGTGTGGTGG + Intergenic
1102931980 12:116869267-116869289 AGTCCATAGGCTGGGTGTGGTGG - Intronic
1102954709 12:117052060-117052082 AGTTAGAGGGCTGGGTGTGGTGG - Intronic
1103454767 12:121056555-121056577 AAACTTAGGGCTGGGTGTGGTGG + Intergenic
1103570734 12:121843031-121843053 CATTTTAGGACTGGGTGTGGTGG - Intronic
1103964094 12:124627110-124627132 AGTCCCATGGCTGGGTGCGGTGG - Intergenic
1104214856 12:126725666-126725688 AGCCCTAGGTGTGTGTGTGGGGG + Intergenic
1104440280 12:128788415-128788437 AGTCACATGGCTGGGTGTGGTGG + Intergenic
1104687642 12:130798289-130798311 AACCCTAGGGCTGGGTGTGGTGG - Intronic
1105554041 13:21428571-21428593 ACTATTAGGACTGGGCGTGGTGG + Intronic
1105946148 13:25191605-25191627 AATCTGAGGGCTGGGTGTGGTGG - Intergenic
1106727254 13:32498627-32498649 ATTACTAGGTCCGGGTGTGGTGG - Intronic
1106753921 13:32802289-32802311 AATCCTAGGCCTTGATGTGGGGG - Intergenic
1106765810 13:32913257-32913279 AGACCTATAACTGGGAGTGGGGG - Intergenic
1107527755 13:41249899-41249921 AGACTAAGGGCTGGGTGTGGTGG - Intronic
1107746609 13:43517207-43517229 TGTCCTTAGGCTGGGTGTGGTGG + Intronic
1107893468 13:44934644-44934666 AGTGCTGAGGCTGGGTGTGGTGG - Intergenic
1107932849 13:45320569-45320591 AGTCCTGAGACTGGGTGCGGTGG + Intergenic
1108069418 13:46613102-46613124 ATTTCTAGGGCTGGGCGTGGTGG + Intronic
1108156420 13:47589915-47589937 TCTCCTGGGACTGGGGGTGGGGG + Intergenic
1108509898 13:51147207-51147229 AGACCTTGGACTAGGTGTGGTGG + Intergenic
1108793015 13:53995858-53995880 ATGCTTAGGGCTGGGTGTGGTGG + Intergenic
1109430031 13:62220037-62220059 AGTCCTAAGGCTGGATGTGCTGG - Intergenic
1111190825 13:84804321-84804343 AGTTCTAGGGCTGGGTGTGGTGG + Intergenic
1111199016 13:84909603-84909625 ATTCCTATGGCCGGGTGTGGTGG - Intergenic
1112191729 13:97184696-97184718 TGTTCTTGGGCTGGGTGTGGTGG + Intergenic
1113275626 13:108726271-108726293 ACTCGTAAGGCTGGGTGTGGTGG + Intronic
1113529855 13:111015131-111015153 AGTGATTGGGCTGGGTGTGGTGG + Intergenic
1114174428 14:20307302-20307324 AGTTTTAGGGCCGGGTGTGGTGG - Intergenic
1114301104 14:21379146-21379168 AGATCTAGGGCTGGGTGTGATGG + Intronic
1114450528 14:22822344-22822366 AGGCCCAGGTCTGGCTGTGGGGG + Intronic
1114492639 14:23113038-23113060 AGTGCTAGGTGTGTGTGTGGTGG + Intergenic
1114541799 14:23466221-23466243 AACCCCAGGGCTGGGTGTGGTGG + Intergenic
1114839054 14:26240984-26241006 ATTTATAGGTCTGGGTGTGGTGG - Intergenic
1115234681 14:31197315-31197337 AGGGCTGGGACTGGGCGTGGTGG - Intronic
1115579801 14:34746599-34746621 GGTCCCAGGTCAGGGTGTGGTGG - Intergenic
1115593181 14:34884058-34884080 AATGTTTGGACTGGGTGTGGTGG + Intergenic
1115611814 14:35055703-35055725 AGACTTAGGGCTGTGTGTGGTGG - Intronic
1115616097 14:35096215-35096237 AGACCCAGTACTGGGGGTGGTGG + Intronic
1115649329 14:35391626-35391648 CATCCCAGGGCTGGGTGTGGTGG + Intergenic
1115656393 14:35447578-35447600 AATTTCAGGACTGGGTGTGGTGG + Intergenic
1116190588 14:41660311-41660333 AGTCATATGGCTGGGTGTGGTGG - Intronic
1116842622 14:49834909-49834931 AGTTCTTAGACTGGGTGCGGTGG + Intronic
1117364395 14:55011240-55011262 AGTATTGGGGCTGGGTGTGGTGG + Intronic
1118184984 14:63529340-63529362 AGTCTTTGGGCTGGGTGCGGTGG - Intronic
1118403422 14:65400596-65400618 TGTCTTAAGGCTGGGTGTGGTGG + Intergenic
1118642071 14:67802148-67802170 AGTCCTGGCACTGGGAGTGCTGG + Exonic
1118726565 14:68633112-68633134 AGGCCCAGGGCTGGGTGTGGTGG - Intronic
1118828516 14:69407135-69407157 ATTTCCAGGGCTGGGTGTGGTGG - Intronic
1119014078 14:71031299-71031321 CTTCCTAGCACTTGGTGTGGGGG + Intronic
1119273168 14:73327910-73327932 AGGCTGGGGACTGGGTGTGGTGG - Intronic
1119476782 14:74935002-74935024 AGACCGAGGGCTGGGGGTGGCGG + Intergenic
1119523049 14:75300439-75300461 AGTCATGAGACTGGGCGTGGTGG + Intergenic
1119795871 14:77396534-77396556 ATTCCTTGGGCTGGGTGCGGTGG - Intronic
1120495540 14:85230221-85230243 AATCCTAGGGCCGGGGGTGGTGG - Intergenic
1120756797 14:88252200-88252222 TGTCCTGGGGCTGGGCGTGGTGG - Intronic
1121114911 14:91336791-91336813 AGCTCTGGGACTGGGTGAGGTGG - Intronic
1121233058 14:92372440-92372462 GGTCCCTGGGCTGGGTGTGGTGG + Intronic
1121959764 14:98248265-98248287 AGTTCTAGAGCTGGGCGTGGTGG - Intergenic
1122139601 14:99654581-99654603 AGGGCCAGGACTGGGTGTGAGGG + Intronic
1122163788 14:99805761-99805783 GGTTCTAGGGCTGGGTGTAGTGG - Intronic
1122305573 14:100764167-100764189 AACCCTTGGGCTGGGTGTGGTGG + Intergenic
1122357600 14:101132838-101132860 ATTCCGAGGACAGGGTGTGGGGG - Intergenic
1122874874 14:104659412-104659434 AGCCCTGGGACTGGTTGGGGCGG - Intergenic
1123436754 15:20260206-20260228 AGTCCTAGGGCCAGGTGCGGTGG - Intergenic
1123779008 15:23607068-23607090 AGGCATAGGGCTGAGTGTGGGGG - Intronic
1124102601 15:26709802-26709824 AGGTTTATGACTGGGTGTGGTGG - Intronic
1124568213 15:30835409-30835431 AGGCCTCGGACCGGGTGTGGTGG + Intergenic
1124845960 15:33290298-33290320 AGTCCTTGTCCTGGGTTTGGGGG - Intergenic
1124944202 15:34247990-34248012 AGTCAGAGGGCTGGGTATGGTGG - Intronic
1125064554 15:35467275-35467297 AGACCCAAGACTGGATGTGGTGG + Intronic
1125608797 15:40957305-40957327 AGGCCAAGGGCTGGGTGTGGTGG + Intergenic
1126613014 15:50548961-50548983 AGACATGGGGCTGGGTGTGGTGG + Intergenic
1126642733 15:50844080-50844102 ACTCATAGGGCTGGGTGTGGTGG + Intergenic
1126651229 15:50923062-50923084 AGACCCAAGACTGGGCGTGGTGG - Intronic
1127061417 15:55189892-55189914 ATTTCTAGTATTGGGTGTGGGGG - Intronic
1127141528 15:55982832-55982854 AATTCTAGGGCTGGGGGTGGTGG + Intronic
1127397527 15:58554605-58554627 ATAATTAGGACTGGGTGTGGCGG + Intronic
1127594144 15:60461088-60461110 AGTCCTAGGGATGGGTGGGGTGG + Intronic
1128157394 15:65400654-65400676 TTTCCCAGGGCTGGGTGTGGTGG - Intronic
1128237211 15:66076593-66076615 GGTCTGAGGACTGGATGTGGAGG + Intronic
1128366378 15:67006560-67006582 CATGCTAGGGCTGGGTGTGGTGG - Intergenic
1128394483 15:67210227-67210249 AGTTCTAGGGCTGGGAGCGGTGG + Intronic
1129229673 15:74189947-74189969 TGTCCTATGTCTGGGTGTGGTGG - Intronic
1129244168 15:74269669-74269691 AGTCAGAGGGCTGGGTGGGGTGG - Intronic
1129245736 15:74277702-74277724 AGACCTAGGACTGGGGAGGGAGG - Intronic
1129461299 15:75701362-75701384 AGTGCTGGGACTTGCTGTGGTGG - Intronic
1130679707 15:85985748-85985770 GGTCCCAGAATTGGGTGTGGAGG + Intergenic
1130837052 15:87661655-87661677 TGCCCTAGGCATGGGTGTGGAGG + Intergenic
1131162611 15:90117434-90117456 ATACCTAGAACTGGGTGTGGTGG - Intergenic
1131340207 15:91591782-91591804 AATCTCAGGGCTGGGTGTGGTGG - Intergenic
1131831198 15:96355631-96355653 AGGCCTAGGCATGGGGGTGGGGG - Intergenic
1132424595 15:101704365-101704387 AGTCACAGGGCCGGGTGTGGTGG + Intronic
1133046661 16:3092005-3092027 AGGCCAAGGACTGGGTGTCGCGG - Intronic
1133120519 16:3603940-3603962 TGTCATAGGGCTGGGTGTGGTGG + Intronic
1133173721 16:3998154-3998176 AATCTTAGAGCTGGGTGTGGTGG + Intronic
1134144972 16:11753592-11753614 AGTCTTAGAGCTGGGCGTGGTGG - Intronic
1134164577 16:11919850-11919872 AGTCCTGGGGTGGGGTGTGGTGG - Intergenic
1134822895 16:17260944-17260966 GCCCCTAGGACTGGGCGTGGTGG + Intronic
1135082953 16:19452084-19452106 AGTTCTGGGGCTGGGTGCGGTGG - Intronic
1135136039 16:19885760-19885782 AGGACTAGGACGGGGTGAGGGGG - Intronic
1135201665 16:20442729-20442751 AGTCCCTGGACTGGGTGCAGTGG + Intergenic
1135329847 16:21551815-21551837 AGTACTTGGGCTGGGCGTGGTGG + Intergenic
1135473225 16:22750992-22751014 AGACCTGGGACTGGTGGTGGTGG + Intergenic
1135810412 16:25581620-25581642 ACTCCTGGGGCTGGGTGTGGTGG + Intergenic
1135879326 16:26238860-26238882 AGGCAGAGGGCTGGGTGTGGTGG - Intergenic
1135981441 16:27150624-27150646 AGTCATAAGGCTGGGCGTGGTGG - Intergenic
1136340187 16:29637785-29637807 AGTACTTGGGCTGGGCGTGGTGG + Intergenic
1136847812 16:33590655-33590677 AGTCCTAGGGCCAGGTGCGGTGG + Intergenic
1137303020 16:47172195-47172217 ATCCCCAGGCCTGGGTGTGGTGG + Intronic
1137795825 16:51218194-51218216 ATTACTGAGACTGGGTGTGGTGG - Intergenic
1138238349 16:55405145-55405167 AGTTTTAAGGCTGGGTGTGGTGG + Intronic
1138647182 16:58434159-58434181 AGTCCTGGGAGTGGGGGTGTGGG - Intergenic
1138681504 16:58686636-58686658 AATCCTGCGGCTGGGTGTGGTGG + Intergenic
1139185816 16:64804784-64804806 AGTCCTAAGGCTGGGCGCGGTGG - Intergenic
1139274403 16:65714180-65714202 AAACCTAGGGCTGGGTGGGGTGG - Intergenic
1139439827 16:66960777-66960799 AGGCTTGGGACTGGGTGTGGTGG - Intergenic
1139774831 16:69310615-69310637 AGTTCTAGGGCTGGGTGTACTGG - Intronic
1139822893 16:69734716-69734738 AGTGTTGGGGCTGGGTGTGGTGG - Intergenic
1140229924 16:73109060-73109082 AGTCCTCAGGCTGGCTGTGGAGG - Intergenic
1140579408 16:76211324-76211346 AGTTCTTAAACTGGGTGTGGTGG + Intergenic
1140589602 16:76335993-76336015 AGTCCTAGGAGCAGTTGTGGTGG - Intronic
1141083479 16:81074668-81074690 AGTTATAGGGTTGGGTGTGGTGG - Intronic
1141087158 16:81104242-81104264 TGTTCTAGGGCTGGGTGTGGTGG + Intergenic
1141110439 16:81266991-81267013 AGCCGTAGGCCTGGGTGGGGAGG + Intronic
1141710246 16:85694772-85694794 AGTTTTAAGGCTGGGTGTGGTGG - Intronic
1142042870 16:87906338-87906360 AGTACTTGGGCTGGGCGTGGTGG + Intronic
1203109520 16_KI270728v1_random:1439304-1439326 AGTCCTAGGGCCAGGTGCGGTGG + Intergenic
1142669575 17:1481786-1481808 AGTCATCGGGCTGGGTGAGGTGG - Intronic
1143131809 17:4683145-4683167 GGTCCTAGGAATTTGTGTGGGGG + Intronic
1143763607 17:9122319-9122341 ACTCAGAGGGCTGGGTGTGGTGG - Intronic
1144197282 17:12906645-12906667 AGTTCTGTGGCTGGGTGTGGTGG + Intronic
1144869235 17:18358612-18358634 TGTACTTGGGCTGGGTGTGGTGG + Intronic
1145095094 17:20018541-20018563 AGACCAAGGACTGGGCATGGTGG - Intronic
1145098992 17:20057777-20057799 AACACTTGGACTGGGTGTGGTGG - Intronic
1145837942 17:27968817-27968839 GGGCCTAGGACAGGGTGAGGTGG + Intergenic
1146008599 17:29177765-29177787 GGTCCCAGGCCTGAGTGTGGTGG - Intronic
1146145880 17:30416043-30416065 TGTTCTAGGGCTGGGTGCGGTGG + Intronic
1146416400 17:32637381-32637403 TGTTTTAGGGCTGGGTGTGGTGG + Intronic
1146515630 17:33486950-33486972 AGTCCTAGGTGGAGGTGTGGCGG + Intronic
1146619343 17:34385493-34385515 AGAGCCAGGACTGGGTGTAGTGG - Intergenic
1146698646 17:34933067-34933089 AGTCATAAGGCCGGGTGTGGTGG - Intronic
1146808583 17:35885229-35885251 ACTCCCATGGCTGGGTGTGGCGG - Intergenic
1146953909 17:36924994-36925016 AGGCCTGGGGCTGGATGTGGTGG - Intergenic
1147113883 17:38284322-38284344 AGTCTTGGGGCTGGGTGCGGCGG + Intergenic
1147249430 17:39144184-39144206 AGTGGCAAGACTGGGTGTGGAGG - Intronic
1147330098 17:39693799-39693821 AATAATAGGGCTGGGTGTGGTGG + Intronic
1147574180 17:41589106-41589128 GGTTCTAAGACCGGGTGTGGGGG - Intergenic
1147854639 17:43469836-43469858 AATCCTGGGACTGAGTGTGGTGG + Intergenic
1148249441 17:46062760-46062782 AGTAATTGGGCTGGGTGTGGTGG + Intronic
1148415722 17:47504869-47504891 AGTCTTGGGGCTGGGTGCGGCGG - Intergenic
1148416500 17:47510681-47510703 AGTGCTAGGGCTGGGTATTGTGG - Intergenic
1148631361 17:49111924-49111946 AGTCCTAGCGCCAGGTGTGGTGG - Intergenic
1148736807 17:49869630-49869652 AGTCCTGGGCCCGGGGGTGGGGG - Intergenic
1149719331 17:58827417-58827439 AATCCCAGCACTTGGTGTGGTGG - Intronic
1149883280 17:60314545-60314567 AGAGCTAGAACTGGGGGTGGGGG + Intronic
1150105302 17:62458313-62458335 TGTGCTAGGGCTGGGTGTGGTGG - Intergenic
1150574002 17:66413724-66413746 AGTATCAGGGCTGGGTGTGGTGG + Intronic
1150728299 17:67669401-67669423 AGAAATAGGGCTGGGTGTGGTGG - Intronic
1150919233 17:69465983-69466005 AGACCTTTGGCTGGGTGTGGTGG + Intronic
1150998886 17:70351138-70351160 AGACTTAGGGCTGGGCGTGGTGG + Intergenic
1151248570 17:72815632-72815654 TGTCCTAGGGCCAGGTGTGGTGG + Intronic
1151325642 17:73378387-73378409 ATTTCTAGGGCTGTGTGTGGTGG - Intronic
1151366361 17:73618877-73618899 ACTATTAGGGCTGGGTGTGGTGG + Intronic
1151469869 17:74311324-74311346 AGTGCTAGGGCCGGGTGTGGTGG + Intronic
1151734641 17:75931494-75931516 AACCATAGGGCTGGGTGTGGGGG + Intronic
1151818447 17:76483570-76483592 AGGCCTAGGGCCGGGTGTGGTGG - Intronic
1152068599 17:78124494-78124516 AGCCCTAGGACTGGGGGACGGGG - Intronic
1152423078 17:80204469-80204491 AATCATGGGGCTGGGTGTGGTGG + Intronic
1152703226 17:81829783-81829805 TGTCCCAGCACTGGGTGGGGTGG - Intronic
1152889737 17:82873706-82873728 TGGCCTTGGTCTGGGTGTGGAGG + Intronic
1153006757 18:504150-504172 AGTCCTGGGACCAGGTGCGGTGG + Intergenic
1153611717 18:6892437-6892459 AGTCTTCAGGCTGGGTGTGGTGG - Intronic
1153613767 18:6914700-6914722 AGCACTAGGAATGGGTGAGGGGG - Exonic
1153995995 18:10441870-10441892 AGTGATAGTGCTGGGTGTGGTGG + Intergenic
1154086060 18:11306751-11306773 AGTCCTTGGGCCGGGTGCGGTGG + Intergenic
1154378679 18:13830256-13830278 AATTCAAGGACTGGGTGCGGTGG - Intergenic
1154995553 18:21637009-21637031 AGTCAGAGGGCTGGGCGTGGTGG + Intergenic
1155251854 18:23960484-23960506 ACCTCTGGGACTGGGTGTGGTGG + Intergenic
1156030295 18:32705433-32705455 TGTATTATGACTGGGTGTGGTGG + Intronic
1158062227 18:53358805-53358827 TGTCTTATGGCTGGGTGTGGTGG - Intronic
1158130522 18:54147791-54147813 AGGCATATGGCTGGGTGTGGTGG + Intergenic
1159533135 18:69680791-69680813 ACTCCAAGGACTGGGTGGGAGGG - Intronic
1161125273 19:2552670-2552692 GGTCCCTGGGCTGGGTGTGGTGG - Intronic
1161514004 19:4686605-4686627 AGTTCGATGGCTGGGTGTGGTGG - Intronic
1161805916 19:6442836-6442858 AGTTCAAGGGCCGGGTGTGGTGG - Intronic
1161863152 19:6813764-6813786 AGTCTTGGGGCTGGGTGCGGTGG + Intronic
1161976195 19:7609032-7609054 AATTATAGGGCTGGGTGTGGTGG + Intronic
1162256412 19:9493641-9493663 AAACCTGGGGCTGGGTGTGGTGG - Intronic
1162264636 19:9561597-9561619 ACTTTTTGGACTGGGTGTGGTGG + Intronic
1162299001 19:9833408-9833430 AATCCAAGGGCTGAGTGTGGTGG - Intergenic
1162755379 19:12855332-12855354 AGTTCTAGGGCTGGGTGTAGTGG + Intronic
1163147939 19:15394694-15394716 AGTCTTTGGGCTGGGCGTGGTGG - Intronic
1163163090 19:15477103-15477125 ATGCCTGGGACTGGCTGTGGTGG + Intronic
1163287364 19:16357156-16357178 AGACCTAGTGCTGCGTGTGGTGG - Intronic
1163383494 19:16984720-16984742 AGTAGTGGGGCTGGGTGTGGTGG + Intronic
1163484411 19:17577471-17577493 AGTCCGAGGCCTGGGGGTGGGGG + Intronic
1163867821 19:19789132-19789154 AGGCCTCTGGCTGGGTGTGGTGG + Intronic
1163871907 19:19828983-19829005 AGGCCTCAGGCTGGGTGTGGTGG + Intergenic
1164025441 19:21347282-21347304 AGTCCAAAGGCTGGGTGTGGTGG - Intergenic
1164207526 19:23070901-23070923 ATTCCTGGGAGTGGGGGTGGTGG - Intergenic
1164245116 19:23421750-23421772 TGTGGTAGGACTGGGTGTTGGGG + Intergenic
1164957570 19:32400207-32400229 AGTTCTAGGGCTGGGCATGGTGG + Intergenic
1164981227 19:32616044-32616066 AGTCCTAGGGCTGGGCGCAGTGG + Intronic
1165032746 19:33010064-33010086 AGTCCTAGGGCCAGGTGCGGTGG - Intronic
1165138931 19:33687785-33687807 GCTCCATGGACTGGGTGTGGGGG + Intronic
1165408087 19:35642786-35642808 GTTCCTGGGACTGGGTGGGGAGG + Intronic
1165414769 19:35685977-35685999 AGTAATAGGGCTGGGTGTCGTGG - Intergenic
1166381206 19:42356266-42356288 AGTGCCAGGCCTGGGTGTAGGGG - Intronic
1166748913 19:45155560-45155582 AGTCCTTGGAGTGGATTTGGTGG + Intronic
1166788855 19:45385725-45385747 TGTCCTAGGCGTGGGGGTGGGGG + Exonic
1167068046 19:47201918-47201940 AGAACTAGGGCTGGGTGCGGTGG - Intronic
1167228121 19:48263356-48263378 TGTCCTAAAACTGAGTGTGGTGG + Intronic
1167413814 19:49360305-49360327 ACTCCTAGGACTGAGGGAGGAGG + Intronic
1167635237 19:50650381-50650403 AAACTCAGGACTGGGTGTGGTGG + Intronic
1167880155 19:52450971-52450993 AATCCTACGGCTGGGTGAGGTGG - Intronic
1167974704 19:53215663-53215685 AGAACCAGGGCTGGGTGTGGTGG + Intergenic
1167977343 19:53240531-53240553 ATTTCTAGGGCTGGGCGTGGTGG - Intronic
1168401268 19:56087408-56087430 TGTCCCAGGCCTGGGCGTGGTGG - Exonic
1168477121 19:56684448-56684470 AGTACTAAGGCTGGGTGTGGTGG + Intergenic
1168540068 19:57202691-57202713 ACTCCTAGGGCAAGGTGTGGCGG - Intronic
1168560927 19:57382425-57382447 AGATCTAGGACTGGGCGTAGTGG - Intronic
925387426 2:3471969-3471991 AGTCCTAGGCCTCGGTGTCCTGG + Intronic
926127935 2:10283327-10283349 AGGCCTGGGAATGGGTCTGGAGG + Intergenic
926271437 2:11369640-11369662 ATTCTTAGGACTGGGGTTGGAGG + Intergenic
926736045 2:16074009-16074031 CGTACTAGGCCTGTGTGTGGTGG - Intergenic
926745624 2:16154661-16154683 AGTCCTTGGCTTGGGTGTGCAGG - Intergenic
926760700 2:16276411-16276433 AGTGTTAGGGCTGGGTGCGGTGG + Intergenic
927249464 2:20984753-20984775 AGAACTACGGCTGGGTGTGGTGG + Intergenic
927490626 2:23518768-23518790 AGACCTAGGAGTGACTGTGGAGG - Intronic
927614079 2:24572214-24572236 AGTCCTAGGCCTGGGACAGGTGG + Intronic
927748195 2:25642105-25642127 AGACTTTGGGCTGGGTGTGGTGG - Intronic
927897168 2:26790611-26790633 AGACATAGGGCTGGGTGCGGTGG - Intronic
927920354 2:26967509-26967531 TGTCCTGGGGCTGGGTGTGGTGG + Intergenic
928047228 2:27948481-27948503 AGTGTTAAGGCTGGGTGTGGTGG + Intronic
928084573 2:28337695-28337717 ATTATTAGGGCTGGGTGTGGTGG + Intronic
928721867 2:34130402-34130424 ACCCCTATGGCTGGGTGTGGTGG - Intergenic
928789953 2:34938452-34938474 AATTATAGGGCTGGGTGTGGTGG - Intergenic
928963607 2:36954924-36954946 AGTTCTTGGACTGGGCATGGTGG - Intronic
929125869 2:38522434-38522456 GGTCTTAGGGCTGGGCGTGGTGG + Intergenic
929169647 2:38918752-38918774 TTTCCTGGGGCTGGGTGTGGTGG + Intronic
929580827 2:43080943-43080965 CGGCCTAGGGCTGGGAGTGGTGG - Intergenic
929864086 2:45703245-45703267 ACTCCTTGGGCTGGGTGTGGTGG + Intronic
930010566 2:46935084-46935106 AGTCTTAGGGCTCGGCGTGGTGG - Intronic
930082468 2:47463919-47463941 CATCATTGGACTGGGTGTGGTGG + Intronic
930346014 2:50181943-50181965 ACTCCTAGGACTGTGTGTTAAGG - Intronic
931123842 2:59251886-59251908 TGTCCTGGGGCTGGGTGAGGTGG + Intergenic
931259255 2:60602920-60602942 AGTGTTAGGACAGGGTGTGCTGG - Intergenic
931308451 2:61055490-61055512 AGACCTATGGCTGGGCGTGGTGG - Intergenic
931440142 2:62284236-62284258 ATACCTAAGGCTGGGTGTGGTGG + Intergenic
932704385 2:74011749-74011771 AGAAATAGGGCTGGGTGTGGTGG + Intronic
933663447 2:84946002-84946024 AGTCTATTGACTGGGTGTGGTGG - Intergenic
934119692 2:88827557-88827579 AGTCCCAGGACTGGGGGAAGTGG - Intergenic
934657830 2:96125217-96125239 CGTTCTAGGGCTGGGTCTGGCGG - Intronic
935029872 2:99311580-99311602 AGCCTGAGGGCTGGGTGTGGTGG - Intronic
935053957 2:99549295-99549317 AGTGAAAGGGCTGGGTGTGGTGG + Intronic
935947038 2:108296075-108296097 CGTTCTTGGGCTGGGTGTGGTGG - Intronic
936095603 2:109528492-109528514 GGTCCTGGGACTGGCTGTGGCGG - Intergenic
936163156 2:110100096-110100118 AGTCCCAGGACTGGGGGAAGTGG - Intronic
936679029 2:114749726-114749748 AGTGCTTGGACTGCGTGTGGTGG - Intronic
937123533 2:119458004-119458026 ATGCCTTGGGCTGGGTGTGGTGG + Intronic
937189127 2:120076585-120076607 ATTACTAAGGCTGGGTGTGGTGG - Intronic
937372689 2:121312426-121312448 ATTCCTGGGGCTGTGTGTGGTGG + Intergenic
937716987 2:125043526-125043548 AGTGATAAGGCTGGGTGTGGTGG + Intergenic
937774741 2:125763000-125763022 AGTCTGAGGGCTGGGTGTGGTGG + Intergenic
938026739 2:127955773-127955795 AGTATTAGAGCTGGGTGTGGTGG - Intronic
938316661 2:130334158-130334180 AGTCCTTGGCCTGGGGGTTGGGG - Intergenic
939565835 2:143785433-143785455 AATCCTGAGGCTGGGTGTGGTGG + Intergenic
939941679 2:148358972-148358994 AGTCTTTTGACGGGGTGTGGTGG + Intronic
942028093 2:171930900-171930922 AATCCTATAGCTGGGTGTGGTGG - Intronic
942285838 2:174415068-174415090 AGTCATGGGGCTGGGTGCGGTGG - Intronic
942510716 2:176696847-176696869 TCTCCTAGGAGTGGGGGTGGTGG - Intergenic
944117321 2:196203169-196203191 AGTACTAGGAGTGGGTGAGTCGG - Intronic
944654399 2:201863562-201863584 AGAGCTGGGGCTGGGTGTGGTGG + Intronic
944686142 2:202119652-202119674 GGTTCTAGGAGTGGGGGTGGGGG + Intronic
944900876 2:204214523-204214545 AAACCATGGACTGGGTGTGGTGG - Intergenic
944982203 2:205134233-205134255 AGAAATACGACTGGGTGTGGTGG + Intronic
946436936 2:219663336-219663358 AGTCCTCGGCCTGGGGGTTGGGG + Intergenic
947421473 2:229944878-229944900 AGTTTTGGGGCTGGGTGTGGTGG - Intronic
947585318 2:231352609-231352631 AATCCTAGCAGTGGGTGCGGTGG - Intronic
947805890 2:232967779-232967801 AATCCTAGGACAAGGTGGGGAGG - Intronic
948324623 2:237104005-237104027 GGTAATAGGGCTGGGTGTGGTGG + Intergenic
948496722 2:238354934-238354956 AGTCCTTGGGCTGGGCTTGGTGG - Intronic
1168863930 20:1068039-1068061 AGTCCTAGGACTGATTTTGGGGG - Intergenic
1168893844 20:1310591-1310613 AGTCTTAGAACTGGGAGTGAAGG - Intronic
1169284693 20:4298083-4298105 AGTGCTTGGACTGGGTCTGTTGG + Intergenic
1169357846 20:4923117-4923139 AAATCTAGGACTGGGTGTGGTGG + Intronic
1170189810 20:13634440-13634462 TGTTCTAGGACCAGGTGTGGTGG + Intronic
1171049971 20:21848611-21848633 AGTTCTAGGGATGGATGTGGTGG + Intergenic
1171490853 20:25516059-25516081 AGATCTTGGGCTGGGTGTGGTGG - Intronic
1172013712 20:31861161-31861183 AGTCCTTGGGCTGGGGGAGGGGG - Exonic
1172202509 20:33136369-33136391 AGGCCTAGGACTGAGTGAGATGG - Intergenic
1172256980 20:33527658-33527680 AGACTTAGGGCTGGGTGAGGTGG - Intronic
1172308971 20:33902302-33902324 AGACCTAGGACTGAGCATGGGGG - Intergenic
1172440734 20:34964629-34964651 ATTCCTGGGACTGGGCGCGGTGG + Intergenic
1172501545 20:35431721-35431743 AGCCCTAGGGCAGGTTGTGGTGG + Intergenic
1173473955 20:43345465-43345487 AGTTCTCAGGCTGGGTGTGGTGG - Intergenic
1173642364 20:44612853-44612875 AGTCCCAGTGCTGTGTGTGGCGG + Intronic
1173685120 20:44918036-44918058 AATCTTGTGACTGGGTGTGGTGG + Intronic
1173862464 20:46293188-46293210 ATTGCTAGGACTGGGGATGGGGG - Intronic
1174051206 20:47768784-47768806 AGTGCTGGGACTGGGGGTGGGGG - Intronic
1174282177 20:49447242-49447264 AGCCCTGGGACTGGATGAGGAGG - Intronic
1174357413 20:50007957-50007979 AATCCTACCAATGGGTGTGGAGG + Intergenic
1174573073 20:51517300-51517322 AGTATTATGGCTGGGTGTGGTGG + Intronic
1175856792 20:62125164-62125186 ATTCCTCAGGCTGGGTGTGGTGG - Intronic
1176017533 20:62943444-62943466 AGTCCCTGGCCTGGGTGTGTGGG + Intronic
1176373535 21:6076412-6076434 AGGACTTGGGCTGGGTGTGGTGG + Intergenic
1178201842 21:30415596-30415618 ATACTTAGGGCTGGGTGTGGTGG - Intronic
1178245965 21:30952884-30952906 AGGACTAGGATTGGGAGTGGTGG - Intergenic
1178486604 21:33023381-33023403 ATTCCTGGGACGGGGTGGGGAGG + Intergenic
1178562071 21:33647781-33647803 AGATCCATGACTGGGTGTGGTGG - Intronic
1178602134 21:34003894-34003916 AGTCCTGGGAATGGAGGTGGTGG + Intergenic
1178765674 21:35448820-35448842 AGTCCTAGCCCTGGGTCTGCTGG - Intronic
1179260080 21:39750353-39750375 AGACCTTTCACTGGGTGTGGTGG + Intronic
1179749942 21:43461831-43461853 AGGACTTGGGCTGGGTGTGGTGG - Intergenic
1180845904 22:18982123-18982145 AAGACTGGGACTGGGTGTGGTGG + Intergenic
1181114684 22:20623997-20624019 AGTGCTTGGAGTGGGGGTGGTGG + Intergenic
1181888146 22:26037911-26037933 AGTCCCAGGAGTGGGTTTGGAGG + Intergenic
1182232605 22:28849851-28849873 AGTCCTCGGGCTGGGCATGGTGG - Intergenic
1182722586 22:32415294-32415316 GGTCCTGGGCCTGGGTGTTGGGG + Intronic
1183366857 22:37411440-37411462 AGTCCCAGCCCTGGGTGAGGAGG + Intronic
1183486317 22:38089300-38089322 ACGCCTGGGACTGGGGGTGGGGG - Intronic
1183545704 22:38454046-38454068 GGTCATGGGACTGGATGTGGGGG + Intronic
1183622561 22:38982893-38982915 AGTCTTAGGAGAGGGTGCGGGGG + Intronic
1183623420 22:38987607-38987629 AGTCTTAGGAGAGGGTGTGGGGG + Intronic
1183627725 22:39014805-39014827 AGTCTTAGGAGAGGGTGTGGGGG + Intronic
1183630231 22:39028064-39028086 AGTCTTAAGAGAGGGTGTGGGGG + Intronic
1183633657 22:39047933-39047955 AGTCTTAGGAGAGGATGTGGGGG + Intronic
1184139465 22:42570132-42570154 AGGCCCAAGGCTGGGTGTGGTGG + Intronic
1184533774 22:45072671-45072693 AGGCCTGGGGATGGGTGTGGGGG - Intergenic
1184797474 22:46740468-46740490 AGTCCTAGGATGGGCTGGGGAGG + Intergenic
1185409320 22:50674148-50674170 AGTCCTAGGCCTCGGTGCGGGGG - Intergenic
950682599 3:14595403-14595425 AGTCCCTGAAATGGGTGTGGGGG - Intergenic
950751799 3:15134920-15134942 ACCCCTAGGAATGGGTTTGGGGG + Intergenic
950867910 3:16204133-16204155 ATTCCTTGGCCAGGGTGTGGAGG - Intronic
951347662 3:21565529-21565551 AGATCAAGGGCTGGGTGTGGTGG - Intronic
951933725 3:27998662-27998684 AGGCCTAGGACTGGAAGGGGTGG + Intergenic
952522817 3:34179238-34179260 AGTCCTTGGGCTGGGCGCGGTGG + Intergenic
952771603 3:37006521-37006543 AATTCAAGGACTGGGTATGGTGG + Intronic
953323843 3:41996041-41996063 AATAATAGGGCTGGGTGTGGTGG - Intergenic
953362871 3:42314457-42314479 AATGATAGGGCTGGGTGTGGTGG - Intergenic
954066916 3:48114057-48114079 AGTTGTGGGGCTGGGTGTGGTGG - Intergenic
954369559 3:50163080-50163102 TGTCCCAGGACTGAGAGTGGAGG + Intronic
954980624 3:54742129-54742151 AGTGCTGGGGCTGGGTGCGGTGG + Intronic
955454857 3:59109168-59109190 AGCCATAGAGCTGGGTGTGGTGG + Intergenic
955576414 3:60369257-60369279 AGTGCCATGGCTGGGTGTGGTGG - Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
955693154 3:61609567-61609589 AGAAATAAGACTGGGTGTGGTGG + Intronic
956875086 3:73454600-73454622 AGTCATTGAACTGGGTGGGGTGG + Intronic
957586237 3:82136106-82136128 AGTAATAGGGTTGGGTGTGGTGG + Intergenic
958949229 3:100399485-100399507 AATACTGGGATTGGGTGTGGTGG - Intronic
959532653 3:107451343-107451365 AGTCTTTGGACTGGGAGTGGAGG - Intergenic
960209252 3:114939711-114939733 AATTCTGGGACTAGGTGTGGTGG + Intronic
960322174 3:116249669-116249691 AGTCTTCTGGCTGGGTGTGGTGG - Intronic
960347542 3:116553057-116553079 AGACCTAGTGCTGGGCGTGGTGG + Intronic
960608144 3:119529235-119529257 AGTTCTTGGGCTGGGTGGGGTGG - Intronic
961348895 3:126286523-126286545 CTACCTATGACTGGGTGTGGTGG - Intergenic
961430657 3:126880372-126880394 AGGCCTTGGATTGGGAGTGGTGG + Intronic
963159136 3:142132448-142132470 TGTTATAGGGCTGGGTGTGGTGG + Intronic
963352443 3:144168342-144168364 AAACCTAGGGGTGGGTGTGGTGG - Intergenic
963876222 3:150478640-150478662 ATACATAGGGCTGGGTGTGGTGG - Intergenic
964106779 3:153048220-153048242 AATATTTGGACTGGGTGTGGTGG + Intergenic
964341235 3:155710543-155710565 AGTTCTATGGCTGGGTGCGGTGG + Intronic
964788030 3:160421214-160421236 AATTATAGGGCTGGGTGTGGTGG - Intronic
965001345 3:162958207-162958229 AAGCCTAGGGCTGGGCGTGGTGG + Intergenic
965270969 3:166617131-166617153 TGTACAAGGGCTGGGTGTGGTGG + Intergenic
965463299 3:168996230-168996252 AGTTTTGGGTCTGGGTGTGGTGG + Intergenic
965558768 3:170042536-170042558 AGTTCATGGGCTGGGTGTGGTGG + Intronic
966925642 3:184642971-184642993 AGTCCTAGGCCTGGGGAGGGAGG + Intronic
967410578 3:189162982-189163004 AGTTCTTAGGCTGGGTGTGGTGG + Intronic
968247180 3:197163822-197163844 ATTCCTAGGGCTGGGTGCAGTGG - Intronic
968359319 3:198136430-198136452 CATCCTGGGACTGGGTGTCGTGG - Intergenic
968414753 4:421316-421338 AGTAATAGGGCTGGGTGTGGTGG - Intergenic
968837178 4:2973594-2973616 TGTCCAAGGATTGAGTGTGGGGG - Intronic
969246338 4:5935498-5935520 ATCCCCAGGGCTGGGTGTGGTGG + Intronic
969448198 4:7257357-7257379 AGACCCAGGCCTGGGGGTGGTGG + Intronic
969933522 4:10658100-10658122 AATCCTGGGAAGGGGTGTGGTGG - Intronic
970202289 4:13622150-13622172 AGTTTTAGGGCTGGGTATGGTGG - Intronic
970339971 4:15095436-15095458 AGTTTTAGGGCTGGGTGTGGTGG - Intergenic
970525837 4:16931226-16931248 AGTCATAGAGATGGGTGTGGGGG + Intergenic
971275947 4:25196997-25197019 TTTCCAATGACTGGGTGTGGTGG - Intronic
972469969 4:39394927-39394949 AGTGAGAGGACTGGGTGTAGTGG + Intergenic
972553929 4:40162212-40162234 AGAGCTGGGGCTGGGTGTGGTGG + Intergenic
973023925 4:45241990-45242012 ACTTATAGGGCTGGGTGTGGTGG - Intergenic
973176487 4:47212387-47212409 AGCCCCAGGGCTGGGTGTGGTGG + Intronic
973310981 4:48709205-48709227 ATACCTAGGGCTGGGTGCGGTGG - Intronic
973320198 4:48802427-48802449 AGTCACACGGCTGGGTGTGGTGG + Intergenic
973800204 4:54470334-54470356 AGTCCTTTAGCTGGGTGTGGTGG + Intergenic
973909688 4:55566714-55566736 ATTCCTGGGGCTGGGTGCGGTGG - Intronic
975858748 4:78653466-78653488 AATGCTAGGACTGGGAGTAGAGG + Intergenic
976506696 4:85855417-85855439 AATCTGATGACTGGGTGTGGTGG + Intronic
977182789 4:93898315-93898337 AATCACAGGACTGGGCGTGGTGG - Intergenic
977423113 4:96828690-96828712 ATTCCTGAGGCTGGGTGTGGTGG - Intergenic
977437629 4:97019519-97019541 CTTCCTAGGCCTGGCTGTGGAGG - Intergenic
978163780 4:105581876-105581898 ATTCCTATGGCCGGGTGTGGTGG + Intronic
978256296 4:106696676-106696698 AGTCCTGGGGCTGGGTGCGGTGG + Intergenic
978583299 4:110253530-110253552 AATAATTGGACTGGGTGTGGTGG - Intergenic
980701278 4:136434418-136434440 TGTACCTGGACTGGGTGTGGTGG - Intergenic
981730159 4:147888415-147888437 AGTCTTGGGAGTGGGAGTGGGGG + Intronic
982016822 4:151162860-151162882 AATCCTGTGGCTGGGTGTGGTGG - Intronic
982246708 4:153360072-153360094 TGTTCCAGGGCTGGGTGTGGTGG - Intronic
982394719 4:154903750-154903772 AGTCCTGAGGCTGGGTGTGGTGG + Intergenic
984314094 4:178103681-178103703 TTTCCTAGGGCTGGGTGTGGGGG - Intergenic
984577938 4:181473299-181473321 CATCCTAGGACTGAGTGCGGTGG + Intergenic
984704925 4:182840660-182840682 TACTCTAGGACTGGGTGTGGTGG + Intergenic
984949767 4:184998769-184998791 AGTATTTGGGCTGGGTGTGGTGG + Intergenic
985108389 4:186521224-186521246 TGTGCTAGTTCTGGGTGTGGTGG + Intronic
986015984 5:3757463-3757485 AGTGCTGGGGCTGGGCGTGGGGG + Intergenic
986068193 5:4256326-4256348 AGACCTGGGAATGGATGTGGAGG - Intergenic
986512649 5:8524552-8524574 TGCCCAAGGACTGGCTGTGGAGG + Intergenic
986810510 5:11353515-11353537 ATTCCTAGGGCTGGGTGCAGTGG + Intronic
987350806 5:17020209-17020231 AGATCTAGGGCCGGGTGTGGTGG + Intergenic
987427391 5:17788975-17788997 AGAGCTTGGGCTGGGTGTGGTGG + Intergenic
988858527 5:35252791-35252813 AGGCAGAGGACTGTGTGTGGGGG + Intergenic
990408663 5:55518118-55518140 AGTCTTAGGGCTGGGTGCGGTGG - Intronic
991623570 5:68572346-68572368 TTTCCAAGGGCTGGGTGTGGTGG - Intergenic
992098547 5:73383388-73383410 AGTCCTTGGAGTAAGTGTGGGGG - Intergenic
992133937 5:73723471-73723493 ATTCTTGGGGCTGGGTGTGGTGG - Intronic
992224444 5:74606396-74606418 AGTCATGGGGCCGGGTGTGGTGG + Intergenic
993730106 5:91412410-91412432 AGTGTTGGGGCTGGGTGTGGTGG - Intergenic
994093169 5:95826225-95826247 AGTCCATGGGCTGGGCGTGGTGG + Intergenic
994343854 5:98662740-98662762 AGTTCTTGGGCTGGGCGTGGTGG + Intergenic
994683298 5:102917019-102917041 AGGCCTGTGGCTGGGTGTGGTGG - Intronic
995490369 5:112684717-112684739 AGTCTGAGGACTGTGTGTGTTGG + Intergenic
995601300 5:113799728-113799750 AGAACTTGGGCTGGGTGTGGTGG - Intergenic
995882236 5:116855974-116855996 AGTTCAAAGGCTGGGTGTGGTGG + Intergenic
996570068 5:124924082-124924104 AGTAATAGGCCTGAGTGTGGAGG - Intergenic
997249349 5:132376832-132376854 AAATCTAGGACTGGGAGTGGAGG - Intronic
997296539 5:132772338-132772360 TGTCCTAGGCCTGGGGGTTGGGG - Intronic
997461900 5:134058600-134058622 AGTCCTTGGGCCGGGTGCGGTGG - Intergenic
997853764 5:137355474-137355496 AGAGTCAGGACTGGGTGTGGTGG - Intronic
998196350 5:140075940-140075962 ATTTTTAGGGCTGGGTGTGGTGG - Intergenic
998320257 5:141223655-141223677 GGACCTAGGGCTGGGGGTGGAGG + Exonic
998322473 5:141245728-141245750 TGACCTAGGGCTGGGAGTGGGGG + Exonic
998344651 5:141451113-141451135 AATCATAAGGCTGGGTGTGGTGG - Intronic
998402306 5:141854101-141854123 AGTCCGAGGTCTGGGTCAGGGGG + Exonic
998413015 5:141925346-141925368 AGACCAGGGACTGGGTGCGGTGG - Intronic
999421236 5:151446242-151446264 AAGCATAGGACTGGGTATGGTGG + Intronic
1001088738 5:168721291-168721313 AGGCCCAGGATTGGGGGTGGTGG + Intronic
1001207191 5:169775195-169775217 AGGCATATGGCTGGGTGTGGTGG - Intronic
1001228203 5:169963657-169963679 ACTCCCAAGACTGGGTGAGGGGG - Intronic
1001315615 5:170639283-170639305 AGTCTCAGGGCTGGGTGTTGTGG - Intronic
1001380737 5:171304855-171304877 AGTCACAGGACTGAGTGGGGAGG - Intergenic
1001438860 5:171722546-171722568 ATTCCTGAGGCTGGGTGTGGTGG - Intergenic
1001818260 5:174689650-174689672 AGTCGTACGGCTGGGCGTGGTGG + Intergenic
1002196675 5:177504955-177504977 AGACCCAGCCCTGGGTGTGGGGG + Intronic
1002848419 6:969229-969251 AGTCCTGGGAGTGGGCGTGTGGG - Intergenic
1003661692 6:8068154-8068176 AGTATTAGCACCGGGTGTGGTGG + Intronic
1003947637 6:11089917-11089939 AGCTCAAGGGCTGGGTGTGGTGG + Intergenic
1004980148 6:21014314-21014336 AGTTCTCGGGCCGGGTGTGGTGG + Intronic
1005090342 6:22050202-22050224 TGACAAAGGACTGGGTGTGGAGG - Intergenic
1005703663 6:28429866-28429888 TGTCCTGGGACTGTGTGTGTAGG - Intergenic
1005981106 6:30837296-30837318 AAAACTAGGCCTGGGTGTGGTGG - Intergenic
1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG + Intronic
1006585475 6:35107866-35107888 AGCTCCAGGGCTGGGTGTGGTGG - Intergenic
1006886647 6:37387627-37387649 AGACCCAGGACTGGGCGTGGTGG - Intronic
1006907045 6:37539572-37539594 TGTCACAGGACTGGGTGGGGAGG - Intergenic
1007525529 6:42489283-42489305 AGTTCTCTGGCTGGGTGTGGTGG + Intergenic
1007722497 6:43893438-43893460 AGTCCTGGGGCTGAGTGGGGTGG - Intergenic
1007752251 6:44077453-44077475 GGTGCCAGGACTGGGGGTGGGGG + Intergenic
1008293983 6:49754884-49754906 AAACCAAGGTCTGGGTGTGGTGG - Intergenic
1008601600 6:53101500-53101522 AGAAATAGGGCTGGGTGTGGTGG + Intergenic
1008637894 6:53430366-53430388 AGGTCTAGGACTGAGTGTGGAGG + Intergenic
1008967124 6:57323801-57323823 TGTTTTGGGACTGGGTGTGGTGG + Intronic
1010469828 6:76214204-76214226 AATCTTAGGACTGGGCGTGGTGG + Intergenic
1010792699 6:80083190-80083212 AGATATAGGGCTGGGTGTGGTGG - Intergenic
1011310744 6:85976908-85976930 AGGCATAGGACTGGGTGCAGTGG - Intergenic
1012477107 6:99625826-99625848 AATCCTGAGGCTGGGTGTGGTGG + Intergenic
1013241769 6:108252923-108252945 ATTCTTAGGGCCGGGTGTGGTGG - Intronic
1013660986 6:112296783-112296805 AGGCCAAGGACTGGGTCTTGGGG + Intergenic
1014200184 6:118600607-118600629 AACCCCAGGGCTGGGTGTGGTGG - Intronic
1014415354 6:121176886-121176908 ATACCTTGGGCTGGGTGTGGTGG - Intronic
1014428924 6:121342769-121342791 AGTACAGGGGCTGGGTGTGGTGG + Intergenic
1014607551 6:123495651-123495673 AATGTTAGGGCTGGGTGTGGTGG - Intronic
1015115337 6:129642581-129642603 AGTCTTATGCCTGGGTGTGGTGG - Intronic
1015120783 6:129699123-129699145 AGTGCTTCGGCTGGGTGTGGTGG - Intronic
1015234453 6:130954338-130954360 AGTTTTAGGGCTGGGTGCGGTGG - Intronic
1015970273 6:138736523-138736545 ATTCAAAGGACTGGGTGGGGTGG + Intergenic
1017128971 6:151091723-151091745 AGTCGTAGGGGTGGCTGTGGCGG + Intronic
1017249625 6:152264920-152264942 AATCTTAGGGCTGGGCGTGGTGG + Intronic
1017768159 6:157623833-157623855 TGTATTAGGGCTGGGTGTGGTGG - Intronic
1017864117 6:158427776-158427798 AATTTTAGGGCTGGGTGTGGTGG - Intronic
1018004867 6:159612508-159612530 ACACGTAGGGCTGGGTGTGGTGG - Intergenic
1019260675 7:80246-80268 CATCCTGGGACTGGGTGTCGTGG + Intergenic
1019819871 7:3234417-3234439 TGTCAAAGGGCTGGGTGTGGTGG + Intergenic
1019949960 7:4363678-4363700 AATCCTGGGAGTGTGTGTGGAGG - Intergenic
1020044415 7:5030530-5030552 CGTCCTAGGACTGGGGGTGGGGG - Intronic
1020131308 7:5560081-5560103 AGTCTGTGGGCTGGGTGTGGTGG + Intronic
1020135570 7:5586107-5586129 AGTGCTCGGGCTGGGCGTGGTGG + Intergenic
1020234521 7:6345400-6345422 AGATCGAGGGCTGGGTGTGGTGG - Intronic
1021544455 7:21797504-21797526 AGTTCAAGGGCTGGGTGTGGTGG - Intronic
1023420199 7:39971228-39971250 TTTTCTAGGGCTGGGTGTGGTGG + Intronic
1023962442 7:44938186-44938208 AATCCTAGGACTGAGTGAGTTGG + Intergenic
1024615358 7:51107372-51107394 AATACTAGGGCTGGGTGTGGTGG - Intronic
1025955273 7:66177921-66177943 GGGTCTGGGACTGGGTGTGGTGG + Intergenic
1026188771 7:68105438-68105460 AGTTAAAGGGCTGGGTGTGGTGG - Intergenic
1026279132 7:68906052-68906074 ATTCCTTGGGCTGGGTGCGGTGG - Intergenic
1026794290 7:73356357-73356379 AGTCCTATCACTGGTTGTGATGG + Intronic
1026875013 7:73874333-73874355 AGTCTCATGGCTGGGTGTGGTGG + Intergenic
1027227069 7:76250519-76250541 ATGACTAAGACTGGGTGTGGTGG - Intronic
1028563729 7:92204817-92204839 AGTCCATGGCCTGGGTGTTGGGG + Intronic
1028758274 7:94463521-94463543 TCTCCCAAGACTGGGTGTGGTGG - Intergenic
1029453581 7:100656023-100656045 GGTCCTGGGACTGGGGGTGGGGG + Intronic
1029477098 7:100791692-100791714 ACTACTGGGGCTGGGTGTGGTGG - Intronic
1029504389 7:100953611-100953633 AGTTGTAGGAGTCGGTGTGGTGG - Exonic
1029505266 7:100960073-100960095 AGTTCCTGGACAGGGTGTGGTGG - Exonic
1029505338 7:100960514-100960536 AGTCCTAGTGGTGGGTGGGGAGG - Exonic
1029573206 7:101385104-101385126 AGTCAGTGGACTGGGTGAGGAGG - Intronic
1030116599 7:106066270-106066292 GGGCCCAGGACAGGGTGTGGGGG + Intergenic
1030243365 7:107354389-107354411 TGAACTAGGGCTGGGTGTGGTGG + Intronic
1031602001 7:123721636-123721658 AGACTTAAGGCTGGGTGTGGTGG + Intronic
1031713902 7:125083050-125083072 ATACCTAGGACTGGGAGTGCTGG + Intergenic
1032024234 7:128428945-128428967 AATGGTAGGGCTGGGTGTGGTGG - Intergenic
1032034468 7:128511530-128511552 AGTACTAGGGCTGAGTGTGGTGG - Intergenic
1033289357 7:140069929-140069951 AATCCTAGGGTTGGGTGCGGTGG + Intergenic
1033375486 7:140757573-140757595 AATCCTAAGGCTGGGCGTGGTGG - Intronic
1033575186 7:142674846-142674868 AGTCTTTTGGCTGGGTGTGGTGG + Intergenic
1034005172 7:147464178-147464200 AGTACTAGGGCAGGGTGTGGTGG + Intronic
1034177080 7:149108604-149108626 CCTTCCAGGACTGGGTGTGGTGG + Intronic
1034254767 7:149718800-149718822 AATCCTTCGGCTGGGTGTGGTGG - Intronic
1034396857 7:150832936-150832958 AGTCCTGTGGCTGGGCGTGGTGG - Intronic
1035037775 7:155906617-155906639 TGTCCTGGGGCTGGCTGTGGGGG + Intergenic
1035154883 7:156904330-156904352 ATGCCTAAGGCTGGGTGTGGTGG - Intergenic
1036026573 8:4915636-4915658 CGTCCGAGGTCTGGGTGTGAAGG - Intronic
1036477631 8:9107970-9107992 GGTCTTAGGACTGGGCATGGTGG - Intronic
1036486934 8:9188033-9188055 AGGTCTCGGACTGGGAGTGGTGG - Intergenic
1036806759 8:11840222-11840244 GGTCCTAGGCCTGGGGGTCGGGG - Intergenic
1036814246 8:11889246-11889268 TCTCCAAAGACTGGGTGTGGTGG - Intergenic
1036888367 8:12577592-12577614 ACCCCTAGGGCTGGGTTTGGGGG - Intergenic
1036999018 8:13695450-13695472 AGTCCTATGGGTGGATGTGGAGG + Intergenic
1038038861 8:23707329-23707351 GGACCGAGGAATGGGTGTGGGGG + Intergenic
1038493578 8:27986543-27986565 AATCCTAGGGCTGGGTGAGCAGG + Intronic
1038741030 8:30217102-30217124 AGTACTATGGCTGGGTGTGGTGG + Intergenic
1038965229 8:32564771-32564793 TGTCCTATGGCTGGGCGTGGTGG + Intronic
1039237250 8:35515395-35515417 AGATTTAGGGCTGGGTGTGGTGG + Intronic
1039273287 8:35906758-35906780 AATCATATGCCTGGGTGTGGTGG - Intergenic
1039478376 8:37853658-37853680 AGTCTGATGGCTGGGTGTGGTGG - Intergenic
1041166698 8:55099112-55099134 AGTCCAAGGACTGTGTTTTGAGG + Intergenic
1042932595 8:74028222-74028244 AATACTAAGGCTGGGTGTGGTGG - Intronic
1043311026 8:78859540-78859562 AGGCCCAGGATGGGGTGTGGCGG + Intergenic
1043458636 8:80437407-80437429 GATCCTTGGGCTGGGTGTGGTGG + Intergenic
1044996851 8:97845625-97845647 AGGTCTAACACTGGGTGTGGGGG - Intronic
1046120606 8:109841493-109841515 AAAACTAGGGCTGGGTGTGGTGG - Intergenic
1047637273 8:126778096-126778118 ATACTTAGCACTGGGTGTGGTGG + Intergenic
1047704154 8:127480834-127480856 AGTCCTATGACTTGATGTGGAGG - Intergenic
1047750839 8:127879239-127879261 AGACCCAGGGCTGGGCGTGGTGG + Intergenic
1047955748 8:129973992-129974014 AGGCATAGTACCGGGTGTGGGGG - Intronic
1048110009 8:131457731-131457753 AGACTGAGGGCTGGGTGTGGTGG + Intergenic
1048674566 8:136764071-136764093 AGACACAGGGCTGGGTGTGGTGG + Intergenic
1049150788 8:141034333-141034355 AATCCTTGGTCTGGGCGTGGTGG - Intergenic
1049439223 8:142601584-142601606 CGCCCTGGGAGTGGGTGTGGTGG - Intergenic
1049542746 8:143215855-143215877 AGGGTGAGGACTGGGTGTGGGGG - Intergenic
1050184327 9:2956782-2956804 TGTTCTAGGGCTGGGTGCGGTGG - Intergenic
1051042905 9:12836039-12836061 AGTCTTTCGGCTGGGTGTGGTGG + Intergenic
1051149637 9:14066411-14066433 TGCCCTAGGGCTGGGCGTGGTGG + Intergenic
1051623569 9:19077129-19077151 AGTTATAGGGCTGGGCGTGGTGG - Intronic
1052020813 9:23523344-23523366 ATTCCAAGGACTGGGGTTGGGGG - Intergenic
1052842860 9:33308090-33308112 CATCCTATGGCTGGGTGTGGTGG - Intronic
1053198032 9:36135377-36135399 ACTCCTGGGGCTGGGTGCGGTGG - Intergenic
1053403856 9:37853258-37853280 AATCCCAGGCATGGGTGTGGTGG + Intronic
1054711339 9:68514176-68514198 AGTCCTAATGCTGGGCGTGGTGG + Intronic
1054911259 9:70457397-70457419 AATCCTGGTACAGGGTGTGGTGG + Intergenic
1054928681 9:70614205-70614227 GGGATTAGGACTGGGTGTGGTGG + Intronic
1055724245 9:79210658-79210680 ATTCATAGGACTGGGCATGGTGG - Intergenic
1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG + Intronic
1056201539 9:84281836-84281858 AATTCTAGGGCTGGGTGCGGTGG + Intronic
1057411044 9:94816727-94816749 AGACCTAGGTCTGGGTTAGGAGG + Intronic
1057450407 9:95153956-95153978 AGTGGGAGGGCTGGGTGTGGTGG + Intronic
1057468139 9:95334834-95334856 CTTCCTTGGGCTGGGTGTGGTGG + Intergenic
1057798329 9:98173827-98173849 AGCCTTTGGTCTGGGTGTGGTGG + Intronic
1058579664 9:106441187-106441209 AGGCTTAGGCCTGGGTGCGGTGG - Intergenic
1058709433 9:107666719-107666741 ATCCCAAGGGCTGGGTGTGGTGG + Intergenic
1058947990 9:109876765-109876787 AGTAGTGGGGCTGGGTGTGGTGG - Intronic
1058953620 9:109925917-109925939 CATTCTAGGGCTGGGTGTGGTGG + Intronic
1059299162 9:113298738-113298760 AGGCCAAGGACTGGGTGAGTAGG - Exonic
1059313630 9:113405867-113405889 ATACTTAGGGCTGGGTGTGGTGG + Intergenic
1060200478 9:121649400-121649422 AGTCTGAGGAGTGTGTGTGGAGG - Intronic
1060566894 9:124600929-124600951 AGTAATATGACTGGCTGTGGGGG + Intronic
1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG + Intronic
1061086584 9:128402874-128402896 AAACCTAGGGCCGGGTGTGGTGG - Intergenic
1061187281 9:129062170-129062192 AGTTCTCAGGCTGGGTGTGGTGG - Intronic
1061938064 9:133869273-133869295 AGAGATGGGACTGGGTGTGGTGG - Intronic
1062325541 9:136010836-136010858 AGAACAAGGACAGGGTGTGGGGG + Exonic
1062338764 9:136084236-136084258 AGGACCAGGTCTGGGTGTGGAGG - Intronic
1062372748 9:136248553-136248575 AGCCCTGGGCCTGGGGGTGGTGG + Intergenic
1062611621 9:137377484-137377506 GGACCTAAGGCTGGGTGTGGTGG + Intronic
1062744007 9:138200144-138200166 CATCCTGGGACTGGGTGTCGTGG - Intergenic
1186030730 X:5366386-5366408 ATGTCTAGGGCTGGGTGTGGTGG + Intergenic
1186081711 X:5940827-5940849 AATGTTAGGGCTGGGTGTGGTGG + Intronic
1186129578 X:6452114-6452136 ATCCCAAGGACAGGGTGTGGAGG - Intergenic
1186830177 X:13382287-13382309 AACTGTAGGACTGGGTGTGGTGG - Intergenic
1188282438 X:28286727-28286749 AGTACTCGGGCTGGGCGTGGTGG + Intergenic
1188661277 X:32761861-32761883 AGTCCTCGGGCTGGGCATGGTGG + Intronic
1189400962 X:40668093-40668115 AATACTAAGGCTGGGTGTGGTGG + Intronic
1190180865 X:48191188-48191210 AGCCTAAGGACTGGGCGTGGTGG - Intronic
1190768334 X:53494117-53494139 AGTCCCAGGGCATGGTGTGGTGG + Intergenic
1190949079 X:55124385-55124407 ATTCCTTGGACGGGGGGTGGAGG + Intronic
1191647783 X:63501950-63501972 GTTACTAGGACTGGGTGTTGGGG + Intergenic
1192174410 X:68876850-68876872 CTTCCTGGGACTGGGAGTGGGGG + Intergenic
1192353850 X:70381248-70381270 AATCCCACGGCTGGGTGTGGTGG + Intronic
1193026815 X:76853919-76853941 TATCCATGGACTGGGTGTGGTGG + Intergenic
1194325306 X:92508100-92508122 ATTCATCGGACTGGGTGCGGTGG - Intronic
1195367692 X:104141873-104141895 AGTCCTAGGACTGGGTGTGGTGG - Intronic
1195691305 X:107628261-107628283 AGACGTTGGACTGGGGGTGGAGG - Intergenic
1195874929 X:109530000-109530022 ATTCTTGGGGCTGGGTGTGGTGG - Intergenic
1195922334 X:109995964-109995986 TTTCCAAGGACTGGTTGTGGGGG + Intergenic
1196427787 X:115589661-115589683 ATACCTAGTACTGGGTGTGGTGG + Intronic
1197669646 X:129262436-129262458 AATCCTTGTACTGGGAGTGGGGG - Intergenic
1197727088 X:129783500-129783522 AGTCATAGACCTGGGTTTGGAGG + Intronic
1198378482 X:136062140-136062162 AGCCCTAGGACTGGGTGCAAAGG + Intergenic
1201551558 Y:15222312-15222334 AGTACTGGGGCTGGGTGTGGTGG - Intergenic
1201706749 Y:16946124-16946146 AGTCCATGGGCTGGGTGTGGTGG + Intergenic