ID: 1195370853

View in Genome Browser
Species Human (GRCh38)
Location X:104170806-104170828
Sequence CCTAGCTACCCCAATTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195370853_1195370861 12 Left 1195370853 X:104170806-104170828 CCAACACAATTGGGGTAGCTAGG 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1195370861 X:104170841-104170863 AACTTAAGTGGGTAGAAGAAGGG 0: 1
1: 0
2: 3
3: 26
4: 257
1195370853_1195370860 11 Left 1195370853 X:104170806-104170828 CCAACACAATTGGGGTAGCTAGG 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1195370860 X:104170840-104170862 GAACTTAAGTGGGTAGAAGAAGG 0: 1
1: 0
2: 0
3: 20
4: 184
1195370853_1195370862 13 Left 1195370853 X:104170806-104170828 CCAACACAATTGGGGTAGCTAGG 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1195370862 X:104170842-104170864 ACTTAAGTGGGTAGAAGAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 193
1195370853_1195370859 1 Left 1195370853 X:104170806-104170828 CCAACACAATTGGGGTAGCTAGG 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1195370859 X:104170830-104170852 GGAAAGTAGGGAACTTAAGTGGG 0: 1
1: 0
2: 0
3: 16
4: 175
1195370853_1195370858 0 Left 1195370853 X:104170806-104170828 CCAACACAATTGGGGTAGCTAGG 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1195370858 X:104170829-104170851 AGGAAAGTAGGGAACTTAAGTGG 0: 1
1: 0
2: 1
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195370853 Original CRISPR CCTAGCTACCCCAATTGTGT TGG (reversed) Intronic
904964935 1:34364602-34364624 CCTTGCTACCCAGATTCTGTTGG + Intergenic
907547774 1:55277146-55277168 CCAAGGTACCCCATTTGAGTAGG + Intergenic
923922086 1:238578262-238578284 CTTAGCTGCCATAATTGTGTGGG - Intergenic
1065443735 10:25776104-25776126 CCTAGGTACCCCTTTTCTGTTGG + Intergenic
1073986260 10:109213184-109213206 CCTACGTACCACATTTGTGTGGG + Intergenic
1076151853 10:128168952-128168974 CTTTGCTCCCCCTATTGTGTTGG - Intergenic
1091223339 11:133943843-133943865 CCCTGCTACCCCAATTCTGGTGG - Intronic
1096595954 12:52695635-52695657 CCCAGGTACCCCAACTCTGTGGG - Intronic
1108462609 13:50682169-50682191 ACTAACTACCCCCATGGTGTGGG - Intronic
1110949954 13:81473691-81473713 CCTCCCTACCCCAGTTGGGTAGG + Intergenic
1127394057 15:58529469-58529491 CCTGGTCACCCCAATTGTTTCGG + Intronic
1128451362 15:67807550-67807572 CCTGGCTACCCCCATTTTGCAGG + Intergenic
1131014076 15:89043116-89043138 CCTAGCTACTCCCATGGTTTTGG - Intergenic
1143687517 17:8530125-8530147 CATAGCTACCTCAGGTGTGTTGG - Intronic
1159174864 18:64819291-64819313 CATAGTTACCCCCATTCTGTTGG + Intergenic
1165934555 19:39381247-39381269 CCCATCTCCCCCAATTGTGGGGG + Intronic
925456927 2:4023795-4023817 CTTAGCTTCCTCACTTGTGTTGG + Intergenic
926704694 2:15828680-15828702 CCTAGCCATGCTAATTGTGTAGG + Intergenic
942632644 2:177967822-177967844 CCTAGCTTCCACAATTGTTATGG - Intronic
944615040 2:201451555-201451577 TTTGGCTTCCCCAATTGTGTGGG - Exonic
946467425 2:219924578-219924600 CCTAGCTCCACCAGCTGTGTGGG + Intergenic
1172013261 20:31858598-31858620 CCAGGCTACCCCACTTGCGTGGG - Intronic
1172361896 20:34318509-34318531 CCTAGGTAGCCCAATTTTATTGG + Intergenic
1180501797 22:15936435-15936457 CCTATCATCCCCAATTCTGTGGG - Intergenic
1181522960 22:23459914-23459936 CCTAGTTTCCCCACTTGTGCAGG - Intergenic
969271843 4:6108347-6108369 CCAAGCTACCCCAAGTGTAGAGG + Intronic
987774853 5:22351373-22351395 CTTAGCTAGCCCAGTTGAGTTGG - Intronic
988915109 5:35884192-35884214 ACTTGCTACCCCCATTGTCTGGG + Intergenic
994869970 5:105335361-105335383 CCCAGCTTCCCCAGTTATGTGGG + Intergenic
1007656018 6:43451428-43451450 CCCAGCTTCCCTAATTGTGAGGG + Intronic
1012900350 6:104997813-104997835 CCTAGCATCCCCATTAGTGTTGG + Intronic
1019588368 7:1816637-1816659 CCTAGTTTCCCCACTTGTGCAGG + Intronic
1022249480 7:28593184-28593206 CATAGCTACTCAATTTGTGTCGG + Intronic
1031041446 7:116842586-116842608 CCTGACTTCCCCATTTGTGTTGG - Intronic
1031918050 7:127581558-127581580 CATTGCTACCCCAATTCTCTGGG - Exonic
1041696562 8:60742465-60742487 CCAAGATACCCCAATGCTGTAGG + Exonic
1048595473 8:135861499-135861521 CATAGCTACCCCAATCCAGTGGG + Intergenic
1185950518 X:4427384-4427406 CCTAGGCACACCAATGGTGTAGG - Intergenic
1188068238 X:25687692-25687714 CCTGGCTACCTCACTTGTTTAGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1195370853 X:104170806-104170828 CCTAGCTACCCCAATTGTGTTGG - Intronic
1195873543 X:109513665-109513687 CCTGGCAACCACGATTGTGTTGG - Intergenic
1197777620 X:130129686-130129708 CCCAGGTAGCCCCATTGTGTGGG - Intronic