ID: 1195372615

View in Genome Browser
Species Human (GRCh38)
Location X:104193885-104193907
Sequence CATTATAAGTAGTTATGTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195372615_1195372617 -3 Left 1195372615 X:104193885-104193907 CCGGAACATAACTACTTATAATG 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1195372617 X:104193905-104193927 ATGCTTAGGTCTTATTTCTTTGG 0: 1
1: 0
2: 1
3: 19
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195372615 Original CRISPR CATTATAAGTAGTTATGTTC CGG (reversed) Exonic
906015320 1:42572522-42572544 CATTATAACTAGTGATTTTTGGG + Intronic
906888608 1:49681817-49681839 CATTATAAGTACTTTTGTATTGG + Intronic
908954486 1:69605545-69605567 CTTTAGAAGTAGTTCTGTTAAGG + Intronic
909247024 1:73299134-73299156 GATTTTAAGTAGTTTTATTCAGG - Intergenic
909786022 1:79614689-79614711 CATTATAGTTATTTATATTCAGG + Intergenic
911743689 1:101415981-101416003 CCTGATAATTAGTGATGTTCAGG - Intergenic
916504689 1:165417614-165417636 AATTATAATTAGTTAAGTTGGGG - Intronic
917760891 1:178156033-178156055 TATTTTAAGAAGTTCTGTTCAGG + Intronic
918797026 1:188913447-188913469 CATGATAACTTTTTATGTTCAGG - Intergenic
919405649 1:197179426-197179448 CATTATCAATAATTATGTACTGG - Intronic
923298231 1:232615746-232615768 CATTGGAAGTAGTTTAGTTCTGG - Intergenic
924544613 1:245014951-245014973 AATGATGAGTAGTTATGTTAGGG + Intronic
1062777333 10:163540-163562 TATTATAAGTAGGAATATTCAGG - Intronic
1064771927 10:18731992-18732014 CAATGTAAATAGTTATGATCAGG + Intergenic
1067412216 10:46075105-46075127 AATTATAAGTAATTATATTATGG + Intergenic
1067930735 10:50558930-50558952 GGCTATAAGTAGTTATGTTTTGG + Intronic
1068064955 10:52118916-52118938 GATTTTAAGTAGTTATTTTAAGG - Intronic
1068349464 10:55823796-55823818 CATTATAAGTGGTAGTGGTCAGG + Intergenic
1068725367 10:60295012-60295034 CATTATAAGTAGTTATAACATGG + Intronic
1068824533 10:61420054-61420076 CACTATTAGTAGTTAAGTTTTGG - Intronic
1072870403 10:99113640-99113662 CAGTATTAATAATTATGTTCTGG + Intronic
1073743351 10:106437003-106437025 CATAAAAAGTTGTTATTTTCTGG - Intergenic
1077925407 11:6677686-6677708 CATTATAAGCATTTAAGTTCTGG + Intergenic
1078965825 11:16340936-16340958 CATTATAAATAGATATTTTAGGG - Intronic
1079369924 11:19842804-19842826 CACTTTCAGTAGTGATGTTCAGG - Intronic
1080226526 11:29967599-29967621 CATTATAAATAGTAATATTGGGG + Intergenic
1080899825 11:36479250-36479272 CATTATTATCAGTTATGTACAGG - Intergenic
1081388252 11:42498894-42498916 CATTATAAATGGTAATGATCTGG - Intergenic
1083537939 11:63489275-63489297 CATTATAAATTCTTATGTACTGG - Intronic
1083544958 11:63541909-63541931 CATTATGAATAATTTTGTTCTGG + Intronic
1083558473 11:63652470-63652492 CACTATGACTAGTTCTGTTCAGG - Exonic
1086450853 11:86915234-86915256 CATCACAAGTAATGATGTTCTGG + Intronic
1087375907 11:97340020-97340042 AATTATATGTTGCTATGTTCAGG - Intergenic
1087996345 11:104814009-104814031 TATGATAAGTAGTTGTATTCTGG + Intergenic
1088029065 11:105224037-105224059 TATTATAATTAGTTCTGTGCTGG - Intergenic
1089980916 11:122771705-122771727 CTTAATAAGTATTTATGTCCTGG + Intronic
1095678340 12:44946028-44946050 CATATTAAGTAGTTTTTTTCTGG - Intergenic
1097442394 12:59626324-59626346 GAGTATATCTAGTTATGTTCTGG + Intronic
1097885196 12:64721947-64721969 CATTTTAAGTAATTATTGTCAGG - Intronic
1098581236 12:72101918-72101940 CTTTATAATTAATTATGTTTTGG - Intronic
1098738704 12:74142489-74142511 AATTATATGTACTTATGTCCAGG + Intergenic
1100264356 12:92961370-92961392 CTTTATAAGTGGGTGTGTTCTGG + Intergenic
1107550644 13:41471562-41471584 AATTATAAGTAGTTATGTTTTGG - Intergenic
1111145834 13:84178387-84178409 CATTATAAGCAATTATCTTATGG - Intergenic
1112960123 13:105113914-105113936 CATTATAAGTATTTGTGTGTAGG - Intergenic
1114374789 14:22132683-22132705 CATTACAGGTAGATCTGTTCTGG + Intergenic
1115451261 14:33550423-33550445 CGATATTAGTTGTTATGTTCTGG + Intronic
1117679243 14:58186203-58186225 GATTATGAGTAGTTAAGTTTTGG + Intronic
1120088205 14:80299782-80299804 CATTATAATTAGCTCTGTTATGG - Intronic
1120804766 14:88735527-88735549 GATTATAATTAGTTCTGTTAAGG + Intronic
1125265600 15:37876792-37876814 AATTATAAATTGTTATGCTCTGG - Intergenic
1128305620 15:66597190-66597212 GATTATTAGTAGTTAAGTTTTGG + Intronic
1131023993 15:89124182-89124204 CAATATATGGAGTTATTTTCTGG + Intronic
1137843783 16:51667033-51667055 CATTTTAAGTATTTATTTTGTGG + Intergenic
1140609619 16:76582277-76582299 CATTTGAAATAATTATGTTCAGG + Intronic
1144955010 17:19014773-19014795 CATTATGAGTAATTATGGTCGGG + Intronic
1153720223 18:7894213-7894235 CTTTATAAGGAGTTCTGTACTGG + Intronic
1154264119 18:12864696-12864718 CATTGAAAGTAGGTATGTTCAGG - Intronic
1155935660 18:31750841-31750863 CATTTTAAGTTGTTATGGTGGGG - Intergenic
1156147492 18:34202976-34202998 CATTATAAATATTTGTGTACAGG - Intronic
1158683603 18:59592242-59592264 CAAAATAAATAGTTATTTTCAGG + Intronic
1159230154 18:65596590-65596612 CATTATAAATGGTTTTGTTGTGG - Intergenic
1163895666 19:20056811-20056833 CATTATAAGAACTGATGTTGTGG - Intergenic
1167953251 19:53044644-53044666 CATTATTAGTAAGCATGTTCTGG - Intergenic
926480368 2:13385369-13385391 AATGATATGCAGTTATGTTCAGG + Intergenic
927353175 2:22142863-22142885 CCTTAAAAGTAGTTAAGTTTTGG + Intergenic
931627465 2:64270072-64270094 GACTATAAGTAGTTAAGTTCTGG + Intergenic
931884530 2:66601951-66601973 AATTAAAAGTAGTTGTGTTGTGG - Intergenic
932074336 2:68649168-68649190 GATGATAAATAGTTCTGTTCTGG - Intronic
933589444 2:84215579-84215601 CATTATAGGTAGTAATGTTTTGG + Intergenic
935950239 2:108322149-108322171 CATTACAGGTAAATATGTTCAGG - Intergenic
936393737 2:112101512-112101534 GACTATCAGTAGTTAAGTTCTGG - Intronic
936451585 2:112637646-112637668 GATTAAAAGTAGTTATGTCGGGG + Intergenic
938646744 2:133339077-133339099 CCTTATAATCAGTTATGTGCAGG + Intronic
940229823 2:151438974-151438996 AGTTATCAGTAGTTAAGTTCTGG - Intronic
942023614 2:171891813-171891835 TATTATAATTACTTCTGTTCTGG + Intronic
942332968 2:174848146-174848168 TATTATGAGTAGTTTTGTTGTGG + Intronic
943525919 2:189017271-189017293 GATGAAAAGTAGTCATGTTCTGG + Intergenic
944590894 2:201217083-201217105 CATTCTAAGTGGTTAACTTCAGG + Intronic
947406487 2:229782602-229782624 AATTATAAGTTGTTGTGTACTGG - Intronic
1169909468 20:10635793-10635815 CATTATAATTAGTTAAGAGCTGG + Intronic
1170252468 20:14299691-14299713 CAGGTTAAGTAGTTATGGTCAGG - Intronic
1170523074 20:17208501-17208523 CATTATAAGTTGTTACGTGCTGG + Intergenic
1176863801 21:14030498-14030520 AATTTTTAGTGGTTATGTTCAGG - Intergenic
1178039062 21:28619326-28619348 CCTTATGAGAAGTTATTTTCTGG + Intergenic
1183651779 22:39159660-39159682 GATTATTAGTAGTTAAGTTTTGG + Intergenic
949388441 3:3532065-3532087 CATTATAAAAAATTATTTTCAGG + Intergenic
951645789 3:24889871-24889893 CATTCTAAGAAGTTACCTTCAGG + Intergenic
957439817 3:80230321-80230343 CACTAACAGTAGTTATGTTGAGG + Intergenic
957600625 3:82330886-82330908 CATTATTACTGGTTATGTTAAGG - Intergenic
958830089 3:99076607-99076629 CAAAATAAGTAGATATGTTCTGG + Intergenic
959429525 3:106235914-106235936 GATGAGAAGTAGGTATGTTCTGG - Intergenic
964716592 3:159728847-159728869 CATTAAAAATAGATGTGTTCCGG + Intronic
965095496 3:164219724-164219746 ACTTATCAGTAGTTATGTCCAGG + Intergenic
967280628 3:187819673-187819695 AATTATAAGTAGATATATACAGG + Intergenic
970849418 4:20583509-20583531 CATTAAAAACAGTTAGGTTCAGG + Intronic
971070490 4:23085784-23085806 CACTATCAGTAGTTAAGTTTTGG - Intergenic
971773159 4:30925785-30925807 CATTTTAATTAGTTGAGTTCTGG - Intronic
972969604 4:44556851-44556873 CATTAAAGGTAATTATGTTTGGG - Intergenic
974254102 4:59427405-59427427 CCTGATAATTAGTTATGTTGAGG + Intergenic
974534587 4:63157560-63157582 TATTATAAGGTATTATGTTCGGG - Intergenic
976520863 4:86024487-86024509 TATTATATGTAGTTTTGTTATGG + Intronic
980073638 4:128269707-128269729 CATTATGACTACTTAGGTTCCGG - Exonic
981847172 4:149182706-149182728 CATTACATGTACTTATGTCCAGG - Intergenic
983510114 4:168600651-168600673 CATTATATTTAATTATGTTAAGG - Intronic
984052557 4:174883966-174883988 AATTATTAGTAGTTAAGTTTTGG + Intronic
986455969 5:7918913-7918935 AATTATTAGTAGTTAAGTTAGGG - Intergenic
987149682 5:15026205-15026227 TACTATAAGTCATTATGTTCCGG - Intergenic
987158907 5:15119629-15119651 CATTATTAGGAGTTATATTTTGG + Intergenic
988113240 5:26850835-26850857 CCTCATAAGTGGTTATTTTCTGG - Intergenic
988296009 5:29363141-29363163 GATTATTAGTAGTTAAGTTTTGG - Intergenic
988455443 5:31383276-31383298 CATTATAAGTTGTTTTATCCGGG + Intergenic
991461006 5:66858702-66858724 AATTATAAGTAGATATGTTTTGG - Intronic
992578271 5:78143160-78143182 CATTTTAAGTAATTTTCTTCTGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993736340 5:91480537-91480559 CAGTTTATGTAGTTATTTTCGGG + Intergenic
996744098 5:126830576-126830598 CACTTAAAGTAGTTATGTTAAGG + Intronic
996857316 5:128023372-128023394 TATTATAAATACTTATGTTTGGG - Intergenic
997485057 5:134224347-134224369 CACTAGTAGTAGTTTTGTTCAGG + Intronic
998586261 5:143430938-143430960 CATTATAAGTAATTCTGCTTAGG + Intronic
1004542761 6:16566992-16567014 CATTATAATTAAATATGCTCAGG - Intronic
1006484991 6:34332159-34332181 GATTATTAGTAGTTAAGTTTTGG - Intronic
1008794395 6:55284180-55284202 AATTATAAGTAGGTATATTTGGG - Intergenic
1009644876 6:66387488-66387510 CATTCTAAGTAGTGATGGGCAGG - Intergenic
1010326509 6:74569765-74569787 GATAAAGAGTAGTTATGTTCTGG - Intergenic
1010605343 6:77883011-77883033 CGTTATAAGCAATTATTTTCTGG - Intronic
1011149723 6:84257692-84257714 CATTATAAGGAGATAGGATCAGG - Intergenic
1012824617 6:104131535-104131557 CACTGTAAGTACTTATTTTCTGG - Intergenic
1016159948 6:140866742-140866764 CAGAATAAGAATTTATGTTCAGG - Intergenic
1017346066 6:153382715-153382737 GGTTGTAAGCAGTTATGTTCTGG - Intergenic
1017590644 6:155975007-155975029 CATTTTAAGATTTTATGTTCAGG + Intergenic
1020068547 7:5209884-5209906 CAAAAAAAGAAGTTATGTTCTGG - Intronic
1020709163 7:11584550-11584572 ATTTATAAATAGTTATCTTCAGG + Intronic
1020944427 7:14583940-14583962 CACTATCAGTTGTTATGTTTGGG - Intronic
1021644726 7:22777915-22777937 GACTATAAGTAGTTAAGTTTGGG + Intergenic
1023772715 7:43573018-43573040 ATTTAAAAGTAGTTATGTTGTGG - Intergenic
1027364397 7:77442384-77442406 CCTTATTAGTTGTTATTTTCAGG - Intergenic
1028015094 7:85699484-85699506 CATTATAATGAGTAATTTTCTGG + Intergenic
1035082377 7:156227653-156227675 GATTACAAGTGGTTAAGTTCTGG + Intergenic
1038008524 8:23455648-23455670 CATTTTAAGTAGTCTTTTTCTGG + Intronic
1040037384 8:42883790-42883812 CATTATAATTAATTTTGTTTTGG - Intronic
1044534228 8:93341099-93341121 CATTATAAATATTTTTGTTAAGG - Intergenic
1044688280 8:94850242-94850264 CTGTATAAGCAGTTATGCTCTGG + Intronic
1044861710 8:96530287-96530309 TTTTATAAGTAATTATGTTATGG - Intronic
1045407952 8:101885992-101886014 CATTGTAACTAGTAATGATCAGG - Intronic
1045717158 8:105061011-105061033 TATTATAAATATTTATTTTCAGG - Intronic
1046656659 8:116902124-116902146 CGTTACTAGTAGGTATGTTCTGG - Intergenic
1047167336 8:122453718-122453740 CATTTTAAATAATTATCTTCAGG - Intergenic
1049140637 8:140950711-140950733 CACTATTAGTAGTTAGGTTTTGG + Intronic
1052283608 9:26759748-26759770 CATTATAAGTAGTAATAATATGG + Intergenic
1052374163 9:27698872-27698894 CATTATAAATCTTTATGTACAGG + Intergenic
1052407056 9:28074505-28074527 TATTACAAGCTGTTATGTTCTGG - Intronic
1053654474 9:40202150-40202172 CATTAGAAGTAGTTATCCTTGGG - Intergenic
1053904867 9:42831360-42831382 CATTAGAAGCAGTTATCCTCGGG - Intergenic
1054366589 9:64348367-64348389 CATTAGAAGTAGTTATCCTTGGG - Intergenic
1054530122 9:66174163-66174185 CATTAGAAGTAGTTATCCTTGGG + Intergenic
1054674217 9:67838107-67838129 CATTAGAAGTAGTTATCCTTGGG - Intergenic
1055909889 9:81337103-81337125 CTTTATAGGTAGTGATTTTCAGG - Intergenic
1058278383 9:103077330-103077352 AACTATAAGTAGTTAGGTTTTGG - Intergenic
1060143607 9:121232154-121232176 CATTATAACAAGTTAGGTTTGGG - Intronic
1186975022 X:14892987-14893009 CTTTATAAATAATTATATTCTGG - Intronic
1187649721 X:21389203-21389225 CATGATAATTAGTTATATTATGG + Intronic
1188530302 X:31133009-31133031 CATTAAAAGCAATAATGTTCTGG - Intronic
1189929330 X:45991163-45991185 GGCTATTAGTAGTTATGTTCTGG - Intergenic
1190120269 X:47653352-47653374 CATTAAAACTAGTCAAGTTCAGG - Intronic
1193608024 X:83592607-83592629 CAATATAAGCAGCTATTTTCAGG - Intergenic
1193803244 X:85962876-85962898 CATTCAAGTTAGTTATGTTCAGG + Intronic
1195372615 X:104193885-104193907 CATTATAAGTAGTTATGTTCCGG - Exonic
1197615760 X:128689722-128689744 CATAATAAGTAGTGATTATCTGG - Intergenic
1200977015 Y:9223372-9223394 TATTATAATTAGTTATATTTGGG - Intergenic