ID: 1195373931

View in Genome Browser
Species Human (GRCh38)
Location X:104207065-104207087
Sequence GGGTGGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195373925_1195373931 3 Left 1195373925 X:104207039-104207061 CCACTTTCAATTACATGCAAATT 0: 22
1: 98
2: 205
3: 271
4: 495
Right 1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG No data
1195373924_1195373931 4 Left 1195373924 X:104207038-104207060 CCCACTTTCAATTACATGCAAAT 0: 26
1: 115
2: 189
3: 287
4: 465
Right 1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195373931 Original CRISPR GGGTGGGTTAATGCAAATTG AGG Intergenic
No off target data available for this crispr