ID: 1195373932

View in Genome Browser
Species Human (GRCh38)
Location X:104207066-104207088
Sequence GGTGGGTTAATGCAAATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195373924_1195373932 5 Left 1195373924 X:104207038-104207060 CCCACTTTCAATTACATGCAAAT 0: 26
1: 115
2: 189
3: 287
4: 465
Right 1195373932 X:104207066-104207088 GGTGGGTTAATGCAAATTGAGGG No data
1195373925_1195373932 4 Left 1195373925 X:104207039-104207061 CCACTTTCAATTACATGCAAATT 0: 22
1: 98
2: 205
3: 271
4: 495
Right 1195373932 X:104207066-104207088 GGTGGGTTAATGCAAATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195373932 Original CRISPR GGTGGGTTAATGCAAATTGA GGG Intergenic
No off target data available for this crispr