ID: 1195378875

View in Genome Browser
Species Human (GRCh38)
Location X:104253267-104253289
Sequence CTGTTAAATAAGATAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 622}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195378873_1195378875 -7 Left 1195378873 X:104253251-104253273 CCCATTAACAACTTCGCTGTTAA 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG 0: 1
1: 0
2: 5
3: 57
4: 622
1195378874_1195378875 -8 Left 1195378874 X:104253252-104253274 CCATTAACAACTTCGCTGTTAAA 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG 0: 1
1: 0
2: 5
3: 57
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195378875 Original CRISPR CTGTTAAATAAGATAGAAAA AGG Intronic
900235564 1:1588219-1588241 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
900268103 1:1770360-1770382 CTGTTAAACAAAATAAGAAAAGG + Intronic
901574213 1:10187013-10187035 CTGTTCAAAAAGGTGGAAAATGG + Intergenic
901619848 1:10575066-10575088 CTCTTAAATAAAAAAAAAAAAGG + Intronic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
904633743 1:31863608-31863630 CTGAAAAATAAGATTGAGAAGGG + Intergenic
905136622 1:35805535-35805557 CTGTTAAACCAGATAGTAACTGG - Intergenic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906483415 1:46216344-46216366 CTCTCAAATAAGATAAAATAGGG - Intronic
906591452 1:47028406-47028428 ATATTAAATAACATAGAACATGG + Intronic
906796420 1:48699769-48699791 ATGGGAAATAAGATAGAAACGGG - Intronic
906883234 1:49616022-49616044 CAGTGAAATAGGATATAAAAGGG - Intronic
907114471 1:51956835-51956857 CTGTAAAATAAGTATGAAAATGG - Intronic
908113784 1:60922054-60922076 CTGGTAAATAGTATAGAAGATGG + Intronic
908196554 1:61750981-61751003 AAGTAAAATAAAATAGAAAAGGG - Intronic
908214301 1:61934955-61934977 CTTTTAGATAAGGTAGGAAATGG - Intronic
908296311 1:62717064-62717086 GTGTTGAATAAGATAGATAAAGG - Intergenic
908724585 1:67162061-67162083 TTATTCAATAAGATAGTAAAAGG - Intronic
908970027 1:69816651-69816673 TTTTTAAATTAAATAGAAAATGG - Intronic
909618697 1:77643043-77643065 CTGTACAAAAAAATAGAAAAAGG + Intronic
909892976 1:81030798-81030820 CTGTTACATTAGATATATAATGG - Intergenic
910062218 1:83107339-83107361 GTGTTAAATAAAAGATAAAATGG - Intergenic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
910456366 1:87401450-87401472 CTGTTAGAAAAGAAAGAAGATGG + Intergenic
911411420 1:97512941-97512963 GTGTTAAATAACATCAAAAATGG - Intronic
911512600 1:98826143-98826165 CTGTTAAAAAAAATAAATAAAGG + Intergenic
911843419 1:102715590-102715612 CTGTGAAATAAAATACTAAAAGG + Intergenic
912109747 1:106326828-106326850 CTGTTTAATAAGCCAGAAACAGG + Intergenic
912670021 1:111616887-111616909 CTATTAAAGGAGATAGAAGAAGG - Intronic
913502356 1:119482981-119483003 GTGTTTAAGAAGATTGAAAAAGG - Intergenic
913510170 1:119554140-119554162 CTGTTTAAGAAGTTTGAAAATGG - Intergenic
913513988 1:119587262-119587284 CTGTTTAAGAAGTTTGAAAAAGG - Intergenic
913685688 1:121229854-121229876 CTGTGAAATAAGTTATAAAGAGG + Intronic
914037535 1:144017457-144017479 CTGTGAAATAAGTTATAAAGAGG + Intergenic
914151919 1:145050475-145050497 CTGTGAAATAAGTTATAAAGAGG - Intronic
914807261 1:151000756-151000778 CATTTATATAAGATAGAGAAGGG - Intronic
915917234 1:159947702-159947724 CTGTTAAATGACATTTAAAATGG + Intergenic
916282668 1:163069473-163069495 CTGTTAAATAAGATGTGCAAAGG + Exonic
916631134 1:166613626-166613648 CTCTTAAAGAAGAAACAAAATGG - Intergenic
916755003 1:167760969-167760991 CTGTTAAAAAACAAAAAAAAAGG + Intronic
916987004 1:170202370-170202392 ATGTTAAAGTAGAGAGAAAAGGG - Intergenic
917714726 1:177722500-177722522 CTGTTAAATAAAATATCCAAAGG + Intergenic
918355988 1:183706973-183706995 CAGTTAAACGAGACAGAAAAGGG + Intronic
918551327 1:185745923-185745945 ATTTAAAATAAGACAGAAAAAGG + Intronic
918581398 1:186134870-186134892 CATTTAAATAAGAAAGCAAACGG - Intronic
919518607 1:198558194-198558216 CTGCTAAATAAAATAATAAATGG + Intergenic
920368577 1:205462249-205462271 CTGTAAAATGATAAAGAAAAGGG - Intergenic
920473009 1:206248411-206248433 CTGTGAAATAAGTTATAAAGAGG + Intronic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
921329499 1:214021406-214021428 CTGTAAAATCAGAAAGGAAATGG - Intronic
921630527 1:217428200-217428222 CAGGTAATTAGGATAGAAAAGGG + Exonic
922400465 1:225249050-225249072 CTGTAAAATAAGATTTATAATGG + Intronic
922457775 1:225790748-225790770 GTGTTAAATAAGGGGGAAAAAGG - Intergenic
922686058 1:227639548-227639570 CAGTTAAATGAGGGAGAAAAAGG + Intronic
923082989 1:230677551-230677573 TTTTTAAATAAGATAGCATAAGG + Intronic
923381448 1:233423579-233423601 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
923403631 1:233639195-233639217 ATGCTATATAAGAAAGAAAAAGG - Intronic
923479648 1:234371808-234371830 CTTTTCAAGAAGTTAGAAAAAGG - Intergenic
923495874 1:234523890-234523912 CTTTTATAGAAGATAGTAAAGGG + Intergenic
923979455 1:239304676-239304698 CTGTGAAAGTAGATAAAAAATGG + Intergenic
924429162 1:243982033-243982055 GTGTTAAACAAGATCGAAAAGGG - Intergenic
924438405 1:244066527-244066549 CTGTCAAATAAAACACAAAATGG - Intergenic
1063038635 10:2315001-2315023 TGGTTAAATTAGCTAGAAAAAGG + Intergenic
1063303356 10:4873937-4873959 ATGTTAAAGTAGATAGAGAAAGG + Intergenic
1063757055 10:9024004-9024026 CTGTGAAACCAGCTAGAAAATGG + Intergenic
1064717260 10:18189520-18189542 CTGTTGAACAAAATAGAAAAGGG - Intronic
1066536512 10:36397880-36397902 CTATTACTTAAGTTAGAAAATGG - Intergenic
1066644150 10:37588319-37588341 CTGTTACTTTAGTTAGAAAACGG - Intergenic
1068354494 10:55894254-55894276 CTTTTAATTAAGATAGGAGAAGG + Intergenic
1068894523 10:62185071-62185093 CTGGCAAATTAGTTAGAAAAGGG - Intronic
1068946003 10:62729330-62729352 CTGCTAAAAAAGAAAGAAAAAGG - Intergenic
1069268948 10:66499805-66499827 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1069338752 10:67385974-67385996 CATTTAAATAATATACAAAATGG + Intronic
1069590541 10:69639001-69639023 TTTTTAAAAAAGAAAGAAAATGG - Intergenic
1070206121 10:74263626-74263648 CTTTGAAATAAGACAGAAAATGG - Intronic
1071035933 10:81245854-81245876 CTGTTAAAAACAATAGATAATGG + Intergenic
1071181751 10:82993471-82993493 TTCTTAAATAAGATTTAAAAAGG - Intergenic
1071865546 10:89726500-89726522 GAGTTAAAAAAGAGAGAAAATGG + Exonic
1073939124 10:108673555-108673577 CTCTTCAATAAAATAAAAAAGGG + Intergenic
1074173733 10:110974483-110974505 CATTTTAAAAAGATAGAAAAAGG - Intronic
1074218210 10:111409038-111409060 CACTTAAAAAAAATAGAAAATGG + Intergenic
1076409731 10:130237646-130237668 TTTTTAAATAAGACACAAAAAGG - Intergenic
1077767354 11:5174396-5174418 CTGTTAGATGAGAAAAAAAATGG + Intronic
1077832181 11:5885293-5885315 CTGTTACAGAAGATTAAAAAGGG - Exonic
1078003932 11:7518326-7518348 CAGTTACATGAGAGAGAAAAAGG + Intronic
1078819831 11:14867060-14867082 CTGTTAAAAAAAAAAAAAAAGGG + Intronic
1079780332 11:24594538-24594560 ATGTTAAGTAAGAGAGAGAAAGG - Intronic
1079960543 11:26918158-26918180 CTGTTAGATAAGACACAATAAGG - Intergenic
1080357955 11:31473348-31473370 CTGTAAAATGAGATATCAAAGGG - Intronic
1080503228 11:32889322-32889344 GTGTTAAATATAATAGAAATTGG - Intergenic
1080835867 11:35940586-35940608 CTTTTAAATAAGTTAGTACATGG - Intergenic
1081235183 11:40638609-40638631 CATTTAATTAAGATTGAAAATGG - Intronic
1081243053 11:40730407-40730429 TTCTTCAATAAGATAGAAATGGG + Intronic
1082989610 11:59196154-59196176 TTGTTAAATAAAAGACAAAATGG - Intronic
1085367865 11:75968934-75968956 CTGTTTATTATGAAAGAAAAAGG - Intronic
1085963292 11:81489335-81489357 CTGCTAAATAAGATAGAAATTGG + Intergenic
1086212815 11:84341486-84341508 CTGTTTAAAAACATAAAAAATGG + Intronic
1086752204 11:90511200-90511222 CTCTTAAATAACGCAGAAAAGGG - Intergenic
1087049066 11:93868090-93868112 CAGTTAAACAAGAGAGGAAAAGG + Intergenic
1087617844 11:100508725-100508747 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
1087660225 11:100978888-100978910 CAGTTAAACAAGACAAAAAATGG - Intronic
1087869682 11:103277156-103277178 CTGTTATATAAGGTCTAAAAGGG - Intronic
1088000278 11:104871312-104871334 CTGGTCAATAATACAGAAAAAGG - Intergenic
1088026417 11:105189702-105189724 ATGATAAATAAGAGAGAAAGGGG + Intergenic
1088184647 11:107152421-107152443 TTTTTAAATAAGATACAATATGG + Intergenic
1088379138 11:109173801-109173823 CTGGTAAAGAAGGAAGAAAAGGG + Intergenic
1088395866 11:109368617-109368639 TTATTAAGTAAGATAGTAAAAGG - Intergenic
1088658379 11:112024133-112024155 CTGTTAAAAAAAAAAAAAAATGG - Intergenic
1088716453 11:112553844-112553866 CTGTAAAATGAGAAAGATAAAGG + Intergenic
1089020379 11:115208030-115208052 CTGGTGAATAGTATAGAAAATGG + Intronic
1089229300 11:116957214-116957236 CTTTTTAAAAAGATAGGAAATGG + Intronic
1089657274 11:119959076-119959098 GTGGAAAATAAGATAGAATAGGG + Intergenic
1089838832 11:121396027-121396049 GTGTTAAATTGTATAGAAAATGG + Intergenic
1090707072 11:129347908-129347930 CTGTTAAAAAAGAAATACAATGG + Intergenic
1091018228 11:132073549-132073571 CAGTTAAATAGCATAGAAAGAGG + Intronic
1092343661 12:7697641-7697663 GTGTTAAATAAGATAGAAACAGG - Intergenic
1092531754 12:9350845-9350867 CTGCTGAATAAGGGAGAAAAAGG + Intergenic
1092702655 12:11249199-11249221 CTGTTGAATAAAATGTAAAAAGG + Intergenic
1092868636 12:12786593-12786615 GTGTTAAATAAGATTTAAACTGG - Intronic
1093364902 12:18282063-18282085 CAGTTACATAAAATAAAAAATGG + Exonic
1093395891 12:18681795-18681817 CTTTGAAATGAGAGAGAAAAAGG - Intergenic
1093962048 12:25284856-25284878 CTATTAAATAAAAAAAAAAATGG + Intergenic
1094092508 12:26666540-26666562 CAGTAAAAAAAGAAAGAAAAAGG - Intronic
1094306287 12:29023174-29023196 CAATAAAATAAGAAAGAAAATGG + Intergenic
1094479215 12:30868045-30868067 CTGTTTCAGAAAATAGAAAAAGG - Intergenic
1095282264 12:40367755-40367777 CTGTTGAGTAAGAGAGAAATAGG + Exonic
1095412122 12:41935761-41935783 CTCTTGAATAACATAGAAAAAGG + Intergenic
1095503708 12:42869128-42869150 CTGTAAAGTAAGGTAGAAATTGG + Intergenic
1096308587 12:50500719-50500741 ATATTAGATAAAATAGAAAAAGG + Intergenic
1096371944 12:51076175-51076197 GGGTTAAATTAGATTGAAAAAGG - Intronic
1097552668 12:61096069-61096091 AAGTAAAATAATATAGAAAAAGG - Intergenic
1097625844 12:61999386-61999408 CTGCTAGATAAGAAAGCAAAAGG + Intronic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1098623215 12:72631054-72631076 CTATTAAATAGGATAAAATAAGG - Intronic
1098683212 12:73384359-73384381 ATGTTAAATAAAATGGAAGAGGG - Intergenic
1098905063 12:76153339-76153361 CTGCTAAATAGAATAGAAACTGG - Intergenic
1099120533 12:78684556-78684578 CAGTTAACTAAGAAAGGAAATGG - Intergenic
1099251777 12:80264966-80264988 CTGTTAAATAAGATGCTAATTGG + Intronic
1099355968 12:81636087-81636109 CTGTTAAATGTGAAAGAATATGG + Intronic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1099861449 12:88229396-88229418 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
1100171792 12:91983478-91983500 CTGCAAAATCACATAGAAAAGGG + Intergenic
1100314313 12:93430121-93430143 CTGGTATAAAAGATAAAAAATGG - Intronic
1100414774 12:94360232-94360254 GTGTTGAATAAGATTGACAAGGG - Intronic
1100665916 12:96752946-96752968 CTGTCAAATAAGCTTGATAATGG + Intronic
1100677451 12:96882966-96882988 CTGATATAAAAGATAAAAAATGG + Intergenic
1101189288 12:102314527-102314549 CTTTTAAGTAAGCTACAAAAGGG + Intergenic
1101880312 12:108621892-108621914 CTGTTAAAGAAAAAAAAAAATGG - Intergenic
1102509062 12:113402113-113402135 CAGTTAATTCAGATAGACAAGGG - Intronic
1103423052 12:120805505-120805527 CTGTACAATAAGGGAGAAAAAGG + Intronic
1104263444 12:127206872-127206894 CTGTTAAATGAGGTAAACAATGG - Intergenic
1104574112 12:129950980-129951002 TTGTTAAAAATGATAGAAAAGGG + Intergenic
1105336951 13:19480597-19480619 ATATTACATAAAATAGAAAAAGG + Intronic
1106148360 13:27072908-27072930 CTGATAAATAAAATACACAATGG + Intronic
1106442441 13:29788759-29788781 CTGTGAAATAAGTTTGGAAATGG + Intronic
1107247536 13:38314606-38314628 TTAATAAATAAAATAGAAAAAGG - Intergenic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1107594870 13:41952680-41952702 CTAATAAATAATCTAGAAAAAGG + Intronic
1108030664 13:46225986-46226008 CTGTCAAAAAAAAAAGAAAAAGG - Intronic
1108178030 13:47813998-47814020 CTGCCAGATAAGATAGAATATGG + Intergenic
1108632186 13:52295740-52295762 ATATTACATAAAATAGAAAAAGG + Intergenic
1108654515 13:52516854-52516876 ATATTACATAAAATAGAAAAAGG - Intergenic
1109187679 13:59290032-59290054 ATGTAAAATAAAATAGAAAGAGG + Intergenic
1109615185 13:64825619-64825641 CTGTTATAGAAGAGATAAAAAGG - Intergenic
1109847362 13:68013009-68013031 GTGTAAACTAAAATAGAAAAGGG - Intergenic
1109976152 13:69835196-69835218 CTGTAGAATAAAAGAGAAAAAGG + Intronic
1110078109 13:71275775-71275797 CTGATAAATAATCTGGAAAAGGG + Intergenic
1110697516 13:78508900-78508922 CTTTTAAAGCAGATATAAAATGG + Intergenic
1111610248 13:90596162-90596184 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1112450573 13:99504763-99504785 ATGTAAAATAAGTTAAAAAAAGG - Intronic
1112492017 13:99875324-99875346 CTCTTAATAAAGAAAGAAAAAGG + Intronic
1112601078 13:100856583-100856605 CTGGAAAATAAGATAAAAAGAGG + Intergenic
1112747834 13:102547524-102547546 ATGTTAAATTAGATCCAAAAAGG - Intergenic
1113116594 13:106880432-106880454 CTGTTAACTTAAAGAGAAAATGG + Intergenic
1113268697 13:108648399-108648421 CTGTGAACTAAGACATAAAAAGG - Intronic
1113334105 13:109361680-109361702 CTGTTAAGTAACACAGAAAAAGG - Intergenic
1114237356 14:20834626-20834648 CAGTTAAACGAGAGAGAAAAAGG + Intergenic
1114883680 14:26819597-26819619 TTGTTAGATAAGTTACAAAATGG - Intergenic
1114925227 14:27389005-27389027 TAATTAAATAGGATAGAAAATGG - Intergenic
1116468302 14:45257955-45257977 CTTTTAAATCATATAAAAAAAGG + Intergenic
1116777545 14:49198812-49198834 CTGTAAAATACTATAGAAATAGG + Intergenic
1117198914 14:53368204-53368226 GTCTTAAATAAGATGGAAACTGG + Intergenic
1117298449 14:54399283-54399305 GTTTTAAAGAAGATAGGAAAGGG - Intronic
1117851414 14:59974823-59974845 CTGGTAAATATGAAATAAAATGG - Intronic
1118801086 14:69190602-69190624 GTTTTACATAAAATAGAAAAAGG - Intergenic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1120353341 14:83393304-83393326 TTGTTTAAAAAGAGAGAAAAGGG + Intergenic
1120629848 14:86877377-86877399 GTTTTAAAAAAGATAGACAATGG + Intergenic
1121190146 14:92020358-92020380 CTGATATATAAGACAAAAAAGGG + Intronic
1121586445 14:95066025-95066047 CTTTTAGAAAAGAAAGAAAAAGG - Intergenic
1121775846 14:96590324-96590346 CTGTTGCATAAAACAGAAAAGGG + Intergenic
1121890794 14:97588624-97588646 CTGTTGAAAAAGGTAGAAATTGG + Intergenic
1122216967 14:100211222-100211244 CTGTCAAAAAAGAAAGGAAAGGG + Intergenic
1122483441 14:102062628-102062650 CTTTTAAATAAAAAAAAAAAAGG - Intergenic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1123186820 14:106526237-106526259 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1123785832 15:23672217-23672239 CAGTTCAATAAGACAGGAAAAGG - Intergenic
1124182553 15:27490466-27490488 GTGTTGACTAAGATGGAAAATGG - Intronic
1125136022 15:36343762-36343784 CAAATAAATAAGAGAGAAAATGG + Intergenic
1125347248 15:38730839-38730861 CTGTAGAATAAAATAGAATAGGG + Intergenic
1125548128 15:40523660-40523682 TTATTAAATAGGATATAAAAAGG + Intergenic
1125660612 15:41391919-41391941 TTGTTAAATCTGACAGAAAAGGG + Intronic
1126164337 15:45641582-45641604 CTGTTAACAAATAAAGAAAATGG - Intronic
1126254345 15:46607863-46607885 CTTTTAAAAAATATAGTAAAGGG + Intergenic
1126257862 15:46649191-46649213 CTGTGAAAGAAGAGAGAAAGCGG - Intergenic
1127116709 15:55735025-55735047 TTGGTAAATAAGAAAGGAAAAGG - Intronic
1127889668 15:63238446-63238468 CTAGAAAATAAGAAAGAAAAAGG - Intronic
1128848068 15:70919027-70919049 CTGTTAAAGAAAATAGGAGAAGG - Intronic
1128915354 15:71555339-71555361 CTGATATATAAGATATAAAATGG + Intronic
1129902289 15:79160242-79160264 CTCTTAAATACGGTAGAGAAGGG + Intergenic
1130199859 15:81814992-81815014 CTGTGAAAAAAGAAAAAAAAGGG + Intergenic
1131484752 15:92810444-92810466 GTTTTAAATAAGCAAGAAAAAGG - Intergenic
1132024776 15:98395699-98395721 CTGTTATAAGTGATAGAAAATGG + Intergenic
1132400590 15:101502478-101502500 CTTTTAAAAAAGAAAAAAAAAGG + Intronic
1132918413 16:2368093-2368115 GTGTTTAAAAAGATAGAATAGGG - Intergenic
1134302381 16:13003308-13003330 AGGTTATATAAGTTAGAAAATGG + Intronic
1134400804 16:13908023-13908045 CTTTTTAATAAGATAGACACAGG + Intergenic
1135408134 16:22212977-22212999 CTCTTAAAAAAGAAAGAAAGAGG + Intronic
1135489442 16:22896105-22896127 CTTTTAAAAAAGATAGAGACAGG - Intronic
1135501460 16:22999464-22999486 CTCTTAAAAAAGAAAGAAACAGG + Intergenic
1136481654 16:30545799-30545821 CAGTTAAATCAGAGAGAAAAAGG + Intronic
1138752180 16:59436826-59436848 ATGTTTAAAAAGTTAGAAAAGGG + Intergenic
1138937354 16:61744630-61744652 TAGTTAAAAAACATAGAAAAGGG - Intronic
1139078828 16:63489355-63489377 CTGTTGAAAGAGAAAGAAAAAGG - Intergenic
1140150967 16:72364866-72364888 ATATTAAATAAGAAATAAAACGG - Intergenic
1142779213 17:2167872-2167894 CTGAAAAAAAAGAAAGAAAAAGG - Intronic
1143744531 17:8982101-8982123 CTGTCTAAGAAGTTAGAAAAAGG + Intergenic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1145744475 17:27304760-27304782 TTCCTAAATATGATAGAAAAGGG - Exonic
1145840017 17:27986877-27986899 CTGTCACAAAAGACAGAAAATGG - Intergenic
1146391308 17:32425839-32425861 CTGGTAAATTAGATAAGAAAAGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146812074 17:35911753-35911775 TTGTTAAATAAGAAAAAAATAGG - Intergenic
1146822696 17:35997418-35997440 ATGTTAAGTAAAGTAGAAAATGG + Intronic
1147061206 17:37880001-37880023 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1147295890 17:39482014-39482036 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1147639011 17:41982620-41982642 CAGGTAAATGAGACAGAAAAGGG + Intronic
1147639196 17:41984174-41984196 CAGGTAAATGAGACAGAAAAGGG + Intronic
1149118935 17:53137394-53137416 CTAATAACTTAGATAGAAAAGGG + Intergenic
1150253828 17:63727449-63727471 CTGTTAATTAAGAGGAAAAAAGG - Intronic
1150381078 17:64720094-64720116 TTCTCAAATAAGACAGAAAAAGG + Intergenic
1150669379 17:67177606-67177628 CTGTTAAATAAGAAGGACAGTGG - Intronic
1150728304 17:67669415-67669437 GTATTAAATAACATAGAAATAGG - Intronic
1152492543 17:80647154-80647176 CTGATAAATTATTTAGAAAAGGG - Intronic
1153652324 18:7252071-7252093 ATTTTAAATAAAATAGATAAAGG - Intergenic
1154177851 18:12098143-12098165 CTGCTACATAAGATATAAAGGGG - Intronic
1155674654 18:28415840-28415862 GTGTTTAATTAAATAGAAAAAGG + Intergenic
1155710458 18:28870675-28870697 ATGTTAAATTCTATAGAAAAAGG - Intergenic
1156557966 18:38088783-38088805 CTGATAAAAAAGAGAGAAAAGGG - Intergenic
1156598278 18:38573279-38573301 TTATTAAATAAGAAATAAAAGGG + Intergenic
1156758047 18:40552549-40552571 ATGTTATATTATATAGAAAAAGG + Intergenic
1156766307 18:40660717-40660739 AAGTTTACTAAGATAGAAAATGG + Intergenic
1157849807 18:51037736-51037758 CTGTTAAATAAAAATAAAAATGG - Intronic
1158034885 18:53014940-53014962 ATATTAAATAAGATACATAAAGG - Intronic
1158502212 18:58012787-58012809 ATATATAATAAGATAGAAAAGGG + Intergenic
1158923082 18:62216044-62216066 TTGTTTAATAACATAGAGAAAGG - Intronic
1158925412 18:62252641-62252663 CTGAAAAATAATATAAAAAACGG - Intronic
1158971696 18:62674240-62674262 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
1162309960 19:9900407-9900429 CTGGAAAATGAGACAGAAAAGGG + Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162633378 19:11946168-11946190 CAGTTAAAGAAGAAACAAAATGG - Intronic
1162987690 19:14281644-14281666 CTGTCAAAAAAAAAAGAAAAAGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164237068 19:23346521-23346543 CAGTTAAACAAGAGAGAAAAAGG - Intronic
1164432301 19:28198917-28198939 CTGTTAAAAAAAAAAAAAAATGG - Intergenic
1164952581 19:32350199-32350221 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1167139535 19:47640147-47640169 CTGTCAAATAAGTTAACAAAGGG - Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167961785 19:53111670-53111692 GAGTTATATAAGACAGAAAAAGG + Intronic
925272576 2:2623396-2623418 CTGCTAAATAAAATACAACATGG - Intergenic
925326692 2:3027881-3027903 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
927544151 2:23938553-23938575 CTGTTAAAAAAAAAAAAAAAGGG - Intronic
928062331 2:28127214-28127236 TTTTTAAAAAAGAAAGAAAACGG + Intronic
928144125 2:28756440-28756462 CTGTTTCACAAGAAAGAAAAGGG - Intronic
928894250 2:36242877-36242899 TTGTTAAAGAAGAAAGACAAGGG - Intergenic
928936723 2:36686844-36686866 CTTTTAAATGACAGAGAAAAAGG - Intergenic
929164096 2:38863662-38863684 CTGGTAAATACTATAGAAAATGG - Intronic
929251255 2:39757968-39757990 CTGTTAAAGAACCTAGGAAATGG - Intronic
929843041 2:45491128-45491150 CTCTTAAATAGGAATGAAAAAGG - Intronic
930596282 2:53392106-53392128 CTGTTAAAAACGGGAGAAAATGG - Intergenic
931316779 2:61140421-61140443 CTGTTAACTGAAATAGTAAATGG - Intergenic
931457026 2:62418353-62418375 CAGTAAAATAAGATAAAAATAGG + Intergenic
932017466 2:68046411-68046433 CTGTTAAAAAAGAAAGAGAGAGG + Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932531976 2:72544672-72544694 CTGTTAAAAAATATAAAAGAGGG - Intronic
932638369 2:73413790-73413812 CTGGAAAAAAAGATAGCAAATGG - Intronic
933165618 2:79071518-79071540 CTGTTAAATATGGTGGCAAATGG - Intergenic
933168231 2:79097550-79097572 CAGTTAAACAAGAGAGAAAAAGG + Intergenic
933310383 2:80653048-80653070 CTGTTACAAAAGATAAATAAGGG + Intergenic
933431424 2:82184950-82184972 CCTTAAAATAAGATATAAAAAGG + Intergenic
933804572 2:85988816-85988838 CTGTTTAAAAAGGGAGAAAAAGG + Intergenic
934046679 2:88178480-88178502 ATCTAAAATAAGATAGCAAATGG - Intronic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
935277700 2:101489912-101489934 CTGTTAGTGAAAATAGAAAATGG - Intergenic
935439574 2:103076338-103076360 CTGTTAAATTCAACAGAAAATGG + Intergenic
936044510 2:109176250-109176272 GAGTTTAATAAAATAGAAAAGGG + Intronic
936627916 2:114168343-114168365 CTGACAAATAAGAAACAAAATGG - Intergenic
937173155 2:119897637-119897659 CTATGAAAAAAGAAAGAAAATGG - Intronic
937366152 2:121263234-121263256 GTATAAAATAAAATAGAAAAGGG - Intronic
937587142 2:123566606-123566628 CTTTAAAAAAAGACAGAAAAGGG + Intergenic
937588820 2:123589921-123589943 ATGTTAAGTCACATAGAAAATGG + Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939108115 2:137973559-137973581 CTGTAAACTAAGACAGAAATGGG - Intronic
939411355 2:141829032-141829054 CTGTAGAATAAGATATATAAAGG + Intronic
939421536 2:141977197-141977219 CTGGATAATAAGATAGAAATAGG - Intronic
939496811 2:142935237-142935259 CAGTTAAACAAGAGAGAAAAAGG + Intronic
939711912 2:145532237-145532259 CAATTAATTAAGATATAAAAGGG + Intergenic
939798872 2:146682005-146682027 CTATTTAATAAGAAAGAAAAAGG - Intergenic
939882499 2:147646300-147646322 CTGTGAAATAACATTCAAAAAGG - Intergenic
940185014 2:150974767-150974789 TTGTTAAATAAGATAGGAAAAGG + Intergenic
940611375 2:155996572-155996594 TTGTTAAATAAAATAGAAACTGG + Intergenic
940633543 2:156269013-156269035 GTGATAAATAAGATGGAAACTGG - Intergenic
940697555 2:156998472-156998494 CTGGTATAAAAGATAAAAAATGG + Intergenic
940913388 2:159228646-159228668 CTTTAAAACAAGATAGAAAACGG + Intronic
941391957 2:164925636-164925658 CTGGTAAATAACATAAAAGAAGG + Intronic
941467872 2:165851965-165851987 CAGTAAAAATAGATAGAAAAAGG - Intergenic
941821626 2:169849647-169849669 CTGTTAAGTCAGATAGAATTTGG + Intronic
942155085 2:173120051-173120073 CTTTTAAAAAAGAAAGAAAGAGG - Intronic
942332687 2:174844219-174844241 ATGTTACATAACATAGCAAAAGG + Intronic
942611699 2:177748455-177748477 CAAATAGATAAGATAGAAAAAGG - Intronic
942647279 2:178126835-178126857 CTAATAAATAAAATAGGAAATGG - Intronic
942683224 2:178501634-178501656 CTCTTTAATAAGGAAGAAAAAGG - Intronic
942854970 2:180534651-180534673 ATTTTAAAAAAGAAAGAAAAAGG - Intergenic
943506508 2:188767091-188767113 CTGATGAGTAAGAGAGAAAAGGG - Intronic
943823528 2:192358834-192358856 ATGTTCTATAAGAAAGAAAATGG - Intergenic
944258866 2:197654484-197654506 GGCTTAAATAAGATGGAAAAGGG + Intronic
944537948 2:200729741-200729763 CTGGTATAAAAGATAAAAAATGG + Intergenic
944717223 2:202387217-202387239 CTGTCAAATTAGATAGAATAAGG - Intronic
944926487 2:204470467-204470489 TTGTAAAAGTAGATAGAAAAGGG + Intergenic
946503276 2:220272604-220272626 TTTTTAAGTAAGAAAGAAAATGG + Intergenic
946543282 2:220709130-220709152 ATCATAAAAAAGATAGAAAAGGG - Intergenic
946711184 2:222507814-222507836 CTGTTAAATGAGAAAGCAAGAGG - Intronic
947061423 2:226170868-226170890 TTGTTAAATAAGTTTAAAAATGG - Intergenic
947579536 2:231306039-231306061 CTGTTACATAAGTTACAATAAGG + Intronic
947682117 2:232044381-232044403 CTGTTTAATAAGCTAGAACATGG + Intronic
1168763588 20:366633-366655 TTGTTAAATAGGAAGGAAAAAGG + Intronic
1169133657 20:3182335-3182357 ATTTTACCTAAGATAGAAAATGG + Intergenic
1169240486 20:3974406-3974428 CAGTGCAATAAGGTAGAAAAGGG + Intronic
1169777413 20:9271200-9271222 CTTTCAAATAAGATGTAAAATGG - Intronic
1170196987 20:13699407-13699429 TTCTTTAATAACATAGAAAATGG + Intergenic
1170985008 20:21249648-21249670 CTTTTTAAGAAGAAAGAAAAAGG - Intergenic
1171141292 20:22745900-22745922 CTGGTAAATAAGATGGACAGGGG - Intergenic
1171507181 20:25647120-25647142 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
1171564270 20:26163991-26164013 CTGTTAGAGTAGAAAGAAAAAGG - Intergenic
1173082702 20:39884526-39884548 CTATTAAAAGGGATAGAAAATGG - Intergenic
1174315524 20:49697574-49697596 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1175157212 20:56979205-56979227 ATGTTAAATAATCTAAAAAAGGG + Intergenic
1175582278 20:60109672-60109694 ATGGTATAAAAGATAGAAAATGG - Intergenic
1176703717 21:10092979-10093001 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
1176736609 21:10554571-10554593 ATATTACATAAAATAGAAAAAGG - Intronic
1177071142 21:16510074-16510096 CTGTGAAATAAGACAAAAGAGGG + Intergenic
1177096140 21:16835925-16835947 CTTTTAAAAAAGAGAAAAAATGG + Intergenic
1177746832 21:25225550-25225572 TTGTTAAAGAAGATATACAATGG - Intergenic
1179083225 21:38192792-38192814 ATTTTAAAAAAGAAAGAAAAGGG - Intronic
1179128359 21:38612305-38612327 TTCTAAAATAAGAAAGAAAAAGG - Intronic
1179196119 21:39164129-39164151 TGGTAAAATAAGAGAGAAAAGGG + Intergenic
1179221906 21:39415647-39415669 CTTTTAAAAACTATAGAAAATGG - Intronic
1179424286 21:41261057-41261079 ATGTTAATTAAGATAAAAATGGG - Intronic
1179794235 21:43773402-43773424 ATGTTAAATAGGACAGAAGAGGG - Exonic
1183532528 22:38368104-38368126 ATATTACATAAAATAGAAAAAGG + Intronic
1185143750 22:49118163-49118185 CTGTTGAATAAGTAAGAAAGCGG + Intergenic
949115802 3:321223-321245 CTGTTAAAAATAATAGAGAAGGG - Intronic
949852735 3:8435116-8435138 CTGTGAAAGAAGAAAGGAAAGGG + Intergenic
950375071 3:12564589-12564611 CTGTTAAAAAAGAGAAAAAAGGG - Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
950926005 3:16742726-16742748 CTGTTATAAAAGATAAAATAAGG - Intergenic
951148954 3:19264817-19264839 CTGTGAAATATGATAGTAATAGG - Intronic
951534046 3:23725670-23725692 CTCTAAAAAAAGAAAGAAAAAGG + Intergenic
952119575 3:30226118-30226140 CTGGTAACTATGATAGATAACGG + Intergenic
952135670 3:30416586-30416608 CTGCTATATAAAATGGAAAATGG - Intergenic
952245650 3:31588219-31588241 CTGTTTAATAAGATAGTCACTGG + Intronic
952259990 3:31730465-31730487 ATGTAAATCAAGATAGAAAAAGG - Intronic
952620899 3:35340889-35340911 CTGTGAAAAAAGGTACAAAATGG - Intergenic
952682579 3:36111819-36111841 CTGTTATATAAGAAAGCAATTGG - Intergenic
953309953 3:41867194-41867216 CAGTTTAAGAAGCTAGAAAAAGG - Intronic
953795603 3:45983512-45983534 CTGGTACATAGGATAGACAATGG + Intronic
955509034 3:59661033-59661055 CTGTTAAAAAAAAAAAAAAAAGG - Intergenic
955613473 3:60781479-60781501 ATTTTAAAAAAAATAGAAAAGGG + Intronic
955820363 3:62890087-62890109 CAGTTAAATAATATGGATAACGG - Intergenic
955858983 3:63306509-63306531 CTGGTAAATCTGATAGAAAGAGG - Intronic
956545659 3:70399314-70399336 CTGTTAAATGGGGTAGAAATTGG + Intergenic
956998405 3:74854558-74854580 CTATTAAATAACATTGAATAAGG + Intergenic
957236330 3:77597092-77597114 ATGTTAAATGAGATGGAGAAGGG - Intronic
958577407 3:95969896-95969918 CTGTCAGACAAGATACAAAAAGG + Intergenic
958770958 3:98425160-98425182 CTATTACACAAGATAGAGAAAGG + Intergenic
959560683 3:107777149-107777171 CAGTGAAATATGATAGACAAAGG - Intronic
959852842 3:111110357-111110379 TTTTTAAATCAGATAGTAAATGG + Intronic
960345028 3:116520417-116520439 TTTTTATATAAGGTAGAAAAGGG - Intronic
960699041 3:120423152-120423174 CTGTAAAATAATAAAGAAAATGG - Intronic
960732337 3:120741048-120741070 TTGTTAGATACAATAGAAAATGG + Intronic
961996020 3:131244262-131244284 ATGTGGAATAAGCTAGAAAAAGG - Intronic
962511983 3:136111210-136111232 CAGATATATAAGAGAGAAAAAGG + Intronic
962611561 3:137081507-137081529 CTGTTATAGCAGCTAGAAAATGG + Intergenic
963545655 3:146654779-146654801 GTTTGAAAGAAGATAGAAAATGG + Intergenic
964528640 3:157643433-157643455 CTGTTTTCTAAGATAGATAAAGG + Intronic
964953714 3:162326674-162326696 CAGTTAAATAATACAGGAAAGGG + Intergenic
965167900 3:165220553-165220575 CTATAAAATGTGATAGAAAAAGG - Intergenic
965239969 3:166183384-166183406 CTAGAAAATAAGATATAAAATGG + Intergenic
965270312 3:166608229-166608251 CTCATTAGTAAGATAGAAAATGG - Intergenic
965442477 3:168731825-168731847 CTATAAAATAAGAAACAAAATGG + Intergenic
965675395 3:171189892-171189914 ATGTTAACTAAGAAAAAAAATGG + Intronic
965688454 3:171330363-171330385 CTGCTAACAAAGATAGAAGAAGG + Intronic
965795950 3:172438800-172438822 TTGTCACATAAGATAGGAAATGG - Intergenic
965872142 3:173276448-173276470 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
966418180 3:179710894-179710916 ATGGTATAAAAGATAGAAAATGG + Intronic
966897331 3:184455497-184455519 AAATTAAATAAGAAAGAAAAAGG - Intronic
967275555 3:187770815-187770837 ATGTTAAATGTAATAGAAAACGG + Intergenic
967284914 3:187859561-187859583 TTTTTAAAAAAGAAAGAAAAAGG + Intergenic
968788426 4:2641933-2641955 CTCTTAAAAAAGAAAAAAAAAGG + Intronic
970344346 4:15138794-15138816 CTATAAAATAAGGTAGAACAGGG + Intergenic
970451537 4:16171338-16171360 CTGTGAAAGAAGTAAGAAAATGG - Intronic
970455767 4:16222850-16222872 CTGTTAAAGAAGAAAGAAATGGG + Intronic
970932695 4:21531380-21531402 CTGTCAAGAAAGAAAGAAAAAGG - Intronic
971002020 4:22334141-22334163 ATGGTATATAAGATAAAAAATGG - Intergenic
971045835 4:22804246-22804268 CTGTTTCCTAACATAGAAAATGG + Intergenic
971103035 4:23489716-23489738 TTCTTAAATAAGATGGCAAAAGG - Intergenic
971198449 4:24491471-24491493 CCGTTAAGTAAGAAAGCAAAGGG - Intergenic
971819464 4:31532400-31532422 CTGTTTCAAAAGATTGAAAAGGG - Intergenic
971905896 4:32725496-32725518 CTGTTAAATGAAAAAGAACAAGG + Intergenic
972038890 4:34564339-34564361 TTCTTAAATAAGATACAAAGTGG + Intergenic
972191350 4:36595271-36595293 CAGTAAAATACAATAGAAAAAGG + Intergenic
972414239 4:38823215-38823237 ATGGTAAAGAAGATAAAAAATGG - Intronic
972936619 4:44143908-44143930 TTCTTAAATGAGAAAGAAAATGG + Intergenic
972962478 4:44471099-44471121 CTACTAAATGTGATAGAAAATGG - Intergenic
973159901 4:47003189-47003211 CAGGTAGATAAAATAGAAAAGGG - Intronic
974332755 4:60500931-60500953 ATGTTATATAAGACAGAGAAAGG - Intergenic
974391954 4:61282276-61282298 CAGCTAAAGAAGATTGAAAAAGG + Intronic
974675882 4:65088926-65088948 CTGTAAGATAATATAGAAAATGG - Intergenic
974958708 4:68673815-68673837 CAGTTAAACAAGAGAGAAAAAGG - Intergenic
975399830 4:73922212-73922234 CTGGTAAATAAGAAGGTAAAGGG - Intergenic
976268473 4:83207037-83207059 CTGTCCAATATGTTAGAAAAAGG + Intergenic
976300106 4:83508767-83508789 CAGTTAAATGAGAGAGAAAAAGG + Intronic
976516072 4:85968127-85968149 ATGTTAAATAAAATTGAAACTGG - Intronic
977769458 4:100840043-100840065 AAGTTAAATAAGAAATAAAAAGG + Intronic
978102287 4:104856976-104856998 CTAGTAAATAAGAAAAAAAAAGG + Intergenic
978345076 4:107758298-107758320 CGATTATATAAGATATAAAAAGG - Intergenic
979119030 4:116869645-116869667 TTGTTCAATAAAATAGATAATGG + Intergenic
979660948 4:123254407-123254429 CGGATAAATAAAATAGAAAAAGG - Intronic
980018808 4:127683348-127683370 ATGTGAAATGAGATAGAAGAGGG - Intronic
980054072 4:128062679-128062701 TTGTGAAATAAGATGAAAAAAGG + Intronic
980375935 4:131949332-131949354 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
980392299 4:132162560-132162582 CTGTCATATAAGATAAAAAGTGG - Intergenic
980776687 4:137446036-137446058 CTGGTTTATAAGGTAGAAAAGGG - Intergenic
981148458 4:141353339-141353361 CTGTTAAAAAAAAAAAAAAAGGG + Intergenic
981165090 4:141548354-141548376 CTGTAAAATAAAATAGAACAAGG + Intergenic
981166798 4:141568680-141568702 CTGTTGAATAAGATACAGTAAGG + Intergenic
981167400 4:141577679-141577701 CTGTTAAATGAGCTAGTGAATGG - Intergenic
981434283 4:144701985-144702007 CTGTTAAAAAAGAAAAAATAGGG + Intronic
981444642 4:144821594-144821616 CAGTGCAATAAGAAAGAAAAAGG + Intergenic
982796241 4:159648356-159648378 CTGTTTAAAAAGATATAAATTGG - Intergenic
983098556 4:163595988-163596010 ATATTAGATAAGAAAGAAAAGGG + Intronic
983121382 4:163889707-163889729 CTGTAAAATATGTCAGAAAAGGG - Intronic
983437728 4:167736402-167736424 GAGATAAATAAAATAGAAAACGG - Intergenic
983983385 4:174027030-174027052 TTGTAAAATGAGAAAGAAAATGG - Intergenic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984496914 4:180510164-180510186 CTGTTAAATACGCTTGACAAGGG - Intergenic
984586395 4:181569488-181569510 CTGGAAAATGAGTTAGAAAATGG - Intergenic
984964717 4:185129734-185129756 CTGTGAAAAAAGAAAGAAAAGGG - Intergenic
985314084 4:188635994-188636016 CTGTCACCTAAAATAGAAAACGG - Intergenic
986034725 5:3926651-3926673 CTGACAAAGAAGATGGAAAAGGG - Intergenic
987970413 5:24936864-24936886 CTGTTAAAAAGGAAAGAAAAAGG + Intergenic
988136528 5:27178721-27178743 ATGTTAAATAAGAAAAAAAAAGG + Intergenic
988613534 5:32751260-32751282 TTGTAAAATGAGAGAGAAAAAGG + Intronic
989049466 5:37305202-37305224 CTGTTTAATCTGAAAGAAAATGG + Exonic
989250211 5:39305086-39305108 ATCTTAAATAAGAAAAAAAATGG - Intronic
989297635 5:39848413-39848435 CTGTTCAATAAAATAAATAAGGG + Intergenic
989585873 5:43073570-43073592 CAGTTAAACAAGAGAGAAAAAGG + Intronic
990136975 5:52657507-52657529 GTATTAAATAAGATAGCATATGG - Intergenic
990489617 5:56291409-56291431 CTGCTAAATAAGCTGGCAAATGG + Intergenic
991120938 5:63012532-63012554 CTGATGAATAAAATAAAAAACGG + Intergenic
991279139 5:64891174-64891196 TTCTTTAATAAGATAGAGAATGG + Intronic
991926195 5:71707324-71707346 TTTTTAAAGGAGATAGAAAAAGG - Intergenic
992326223 5:75662922-75662944 CTGAGTAATAAGACAGAAAAGGG - Intronic
992963823 5:81982058-81982080 CTGCTAAAGCAGTTAGAAAAAGG + Intronic
993001358 5:82384473-82384495 CTGTGAAATTAGAGAGAAAGAGG - Intronic
993194998 5:84730587-84730609 TTGTCAAATAAGATTCAAAAAGG - Intergenic
993252400 5:85545569-85545591 CATTTAAATTAGATATAAAACGG - Intergenic
993704310 5:91152433-91152455 CTGTTAAAAAATATAAGAAATGG - Intronic
993936002 5:94003351-94003373 CAGTAAAATAAGATAACAAAAGG + Intronic
994363480 5:98883425-98883447 CTGGTGAAAAAGAAAGAAAACGG + Intronic
995399631 5:111726309-111726331 ATGTTAGATAACATAGAAATTGG - Intronic
995419601 5:111949203-111949225 ATGTTAAATATGCTATAAAATGG + Intronic
995479979 5:112583908-112583930 CTGTTAAAAAAAAAAAAAAAGGG - Intergenic
995562808 5:113401522-113401544 CTGCTAAATGAGAAAGACAATGG - Intronic
996695785 5:126393264-126393286 CTGTGAAATAAAATTGTAAAAGG - Intronic
996826604 5:127689151-127689173 CTGTTATATAATATGGCAAAAGG - Intergenic
996838875 5:127824241-127824263 CTGTTAGAAAGGAAAGAAAAAGG + Intergenic
997298979 5:132788558-132788580 CTGTTAGAAAAGAAAGAGAATGG + Intronic
997374668 5:133389066-133389088 CTCTGAAATGAGATAAAAAATGG - Intronic
997426827 5:133808902-133808924 CTGGAAAATAGAATAGAAAAAGG + Intergenic
998517103 5:142766505-142766527 ATGTTTAATAAGAAAGAAACAGG - Intergenic
998518063 5:142773341-142773363 CTGTAAAATAAAATAAAATATGG - Intronic
998756715 5:145389259-145389281 CTGTTACACAAGATAGTAGATGG + Intergenic
998980745 5:147699319-147699341 TTGTTAAATAAGACAGAATCAGG + Intronic
999058154 5:148604126-148604148 TTCTTAAATAAGATGCAAAAAGG + Intronic
999387901 5:151168276-151168298 CTGTTCAAAAAGAAAAAAAAAGG + Intergenic
1000459876 5:161501396-161501418 CTGCTATATAAAATAGATAATGG - Intronic
1000489208 5:161888315-161888337 CTTTCAAATAAGGAAGAAAAGGG - Intronic
1000601145 5:163276161-163276183 CTGTTTTATAAAATAGAAGAAGG - Intergenic
1000668505 5:164029059-164029081 CCATAAAATCAGATAGAAAAAGG + Intergenic
1000715181 5:164634335-164634357 ATATTAAATGAGATAGAAAATGG + Intergenic
1000956897 5:167554122-167554144 CTGCAAAATAAGTGAGAAAATGG - Intronic
1001389033 5:171363786-171363808 AGGTAAAATAATATAGAAAATGG + Intergenic
1002894021 6:1364533-1364555 CTGGCTAATAAGATAGAAAGAGG - Intergenic
1003007701 6:2397198-2397220 CTGGTAAACAAGAGAAAAAAAGG - Intergenic
1003513238 6:6799047-6799069 CTGTTATAAACAATAGAAAAAGG - Intergenic
1004586804 6:17010555-17010577 TTTTTAAAAAAGAAAGAAAATGG - Intergenic
1004771649 6:18789752-18789774 ATTTTTAATAAGCTAGAAAATGG + Intergenic
1005000755 6:21238765-21238787 CTATTTAAAAAAATAGAAAATGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1008401674 6:51070333-51070355 CTGTTCAAGATGAAAGAAAAAGG - Intergenic
1008455215 6:51702811-51702833 CTGTTAAAAGAGAAAGAAAAAGG + Intronic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1008863046 6:56174338-56174360 GTAATAAATAAAATAGAAAATGG + Intronic
1009286297 6:61822453-61822475 CTGATGAAGATGATAGAAAATGG - Intronic
1009360098 6:62800943-62800965 CTGTTAAAAAAAAGAAAAAAGGG - Intergenic
1009418016 6:63437030-63437052 CTGTCAAAAAAGAAAGAAAAGGG + Intergenic
1009485374 6:64215818-64215840 ATGTTAAATACAATAGAGAAAGG + Intronic
1009597970 6:65760782-65760804 CTGTTAACTGAGAGAGAAGAAGG - Intergenic
1009890959 6:69681339-69681361 CTGTTAAATTACAAAAAAAATGG - Intronic
1010003408 6:70970717-70970739 TTTTTAAATAAGATAATAAAGGG - Intergenic
1010190392 6:73189456-73189478 CTGTCACCTAAGATAGACAATGG + Intronic
1011047889 6:83106919-83106941 ATGTTAAATAAAATAGGATAAGG + Intronic
1011078560 6:83464268-83464290 CTGTGAAAAAAGATTGATAAGGG + Intergenic
1011093303 6:83631593-83631615 CAGTTAAAAAAGACAAAAAAAGG - Intronic
1012649828 6:101738896-101738918 CTGTGAAGTAAAATAGAAAACGG + Intronic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1013700463 6:112762946-112762968 CTGTAAAATAGGAGAGAAAAAGG + Intergenic
1013798667 6:113914350-113914372 ATGTTTAAGAAGATAGAAAATGG - Intergenic
1013917182 6:115354817-115354839 GTGTTAACTAGGAAAGAAAAAGG - Intergenic
1014496200 6:122126449-122126471 TTGTTAAATATCATAGACAAAGG + Intergenic
1014796520 6:125731444-125731466 CTGATAAATATGATAGACAGAGG - Intergenic
1015304598 6:131693747-131693769 CTGCTAAATAGCATACAAAAAGG - Intronic
1015473596 6:133634635-133634657 CTGTTCCCTAAGATAGCAAATGG + Intergenic
1016113557 6:140256216-140256238 CTGTCAAATAAGCTAGATATTGG - Intergenic
1016292253 6:142538546-142538568 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
1016701309 6:147057280-147057302 CTTTTAAATAAGATAAATGATGG + Intergenic
1017436052 6:154416812-154416834 CTGGTAACTAAGCTATAAAATGG + Intronic
1017597180 6:156042268-156042290 TTGTTAAATAAGGTAGCATAAGG - Intergenic
1017851994 6:158312630-158312652 CAGTTAATTAAGATAGGCAAAGG - Exonic
1019833994 7:3362674-3362696 GTGTGAAATAATATTGAAAATGG + Intronic
1020531785 7:9347181-9347203 CTGTAACATAACATAGAAATAGG - Intergenic
1020817989 7:12929491-12929513 CTGATAAGTAAGTTAGATAACGG - Intergenic
1021758426 7:23878687-23878709 TTGTTAAAGAAGAAAAAAAAGGG + Intergenic
1022770698 7:33469496-33469518 TTACTAAATAAGATGGAAAATGG + Intronic
1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG + Intronic
1024441189 7:49419956-49419978 ATGTTAAATAAGGTAAAACATGG + Intergenic
1024628494 7:51228881-51228903 TTGTTCAATATTATAGAAAAAGG + Intronic
1027123742 7:75541090-75541112 TTTTTAAATAAGATAGAGACGGG - Intronic
1027546674 7:79535968-79535990 CTGTACAATAAGATACAAAGTGG - Intergenic
1027560389 7:79720982-79721004 GTGATTAATAAAATAGAAAATGG + Intergenic
1027600734 7:80237547-80237569 ATGTTATAAAAGATAAAAAATGG + Intergenic
1028035723 7:85979234-85979256 CTGTCAAAAAAGAAATAAAAAGG + Intergenic
1028456272 7:91041174-91041196 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1028574066 7:92326750-92326772 CTATTAAATAAGAGAGAAAGAGG - Intronic
1028747433 7:94343479-94343501 CTGTGAAAGAAGAGAGGAAAGGG - Intergenic
1028855066 7:95582150-95582172 CTGTGATGTAAGATAAAAAAGGG + Intergenic
1028898785 7:96072357-96072379 CTGTTAAAGAAAAGGGAAAAAGG - Intronic
1029171552 7:98633146-98633168 CTTTTAAATCAGATAAAAGAAGG - Intergenic
1030166959 7:106564878-106564900 GAGTTAAATAAAATATAAAAAGG - Intergenic
1031113433 7:117639720-117639742 ATGTTTATCAAGATAGAAAATGG - Intronic
1033049067 7:137987844-137987866 CTTTTAAAAAAGGTAGAGAAAGG - Intronic
1033439978 7:141369810-141369832 CTTTTAAATAAGCCATAAAATGG + Intronic
1033838954 7:145350391-145350413 CTGTAAGATGAGAGAGAAAATGG - Intergenic
1034045320 7:147921110-147921132 CTGTTAAACAAAAAAAAAAAAGG - Intronic
1035465704 7:159075149-159075171 CTGTTAAATAAGAATAAAAATGG + Intronic
1036112469 8:5918948-5918970 CTGAAAAATAAAAAAGAAAAAGG - Intergenic
1036615532 8:10384705-10384727 CTGTTAAAGAAAAAATAAAATGG + Intronic
1038655225 8:29444674-29444696 CTTTTAAAGAAGAGGGAAAATGG + Intergenic
1038744407 8:30244743-30244765 CTTTTAAATCGGGTAGAAAAAGG - Intergenic
1039037933 8:33379535-33379557 ATGTTAAAGAATATAGTAAAAGG + Intronic
1039273637 8:35910558-35910580 ATGTAAAATAAGAAATAAAATGG - Intergenic
1039357948 8:36841974-36841996 CTGTTAAAAAAAAAAGAAAAGGG + Intronic
1039507938 8:38065625-38065647 CTGTTTAAGAAAAAAGAAAAAGG + Intergenic
1039521429 8:38175773-38175795 CAGTAAAATAAGCTAGCAAATGG + Intronic
1039547832 8:38422404-38422426 CTCTTAAAAAAGAGAGAGAAGGG - Intronic
1040478403 8:47801596-47801618 CTGTTATAAAAAATAGGAAATGG + Intronic
1040788391 8:51194656-51194678 ATGGTAAATACAATAGAAAATGG + Intergenic
1040844867 8:51826653-51826675 TTGTTAACAAAGATTGAAAACGG + Intronic
1041132609 8:54717738-54717760 CTAATCAATAAGACAGAAAAAGG + Intergenic
1041474318 8:58247161-58247183 CTTTTAAATAAATTAGGAAAAGG - Intergenic
1041795723 8:61745811-61745833 TTTTTAAAAAAGAAAGAAAATGG - Intergenic
1042157961 8:65865229-65865251 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
1042443811 8:68860366-68860388 TTGTTAAATATCATAGACAAAGG - Intergenic
1042864925 8:73348808-73348830 GTGTTAATTAAGATAGTAGATGG - Intergenic
1042983151 8:74553082-74553104 CTGATAAAAGAGTTAGAAAATGG + Intergenic
1043214515 8:77569296-77569318 CTGTTAAAAATGAGAGAAATTGG + Intergenic
1043407525 8:79953176-79953198 TTTTTAAAAAAGAGAGAAAACGG - Intronic
1043588682 8:81799818-81799840 CTGTTATATAAGATACAGAATGG + Exonic
1043709729 8:83401602-83401624 TTCTTAAATAAGATAGTAACAGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044208222 8:89517449-89517471 CAGTAAAACAAGGTAGAAAAAGG - Intergenic
1044256177 8:90064995-90065017 CTGTTATATTAGATTGAAGAAGG - Intronic
1044359807 8:91269718-91269740 CACTTAAAAAAGAGAGAAAAAGG - Intronic
1044627601 8:94249308-94249330 ATTTTGAAAAAGATAGAAAATGG + Exonic
1044787502 8:95809996-95810018 CTGTGAAAGAAGAGAGAAAAGGG - Intergenic
1045041970 8:98233834-98233856 ATGTTAACAAAGATACAAAAAGG - Intronic
1045216286 8:100151662-100151684 ATATTAAATAGGAAAGAAAAAGG - Intronic
1045335042 8:101193466-101193488 TACTTAAATAGGATAGAAAATGG - Intronic
1046016149 8:108607766-108607788 CTGTAAAACAAGCAAGAAAATGG + Intronic
1046123370 8:109873097-109873119 CAGATAAAGGAGATAGAAAAAGG - Intergenic
1047210235 8:122834768-122834790 CAGTTAAATGAGAGAGAAAAAGG + Intronic
1047485626 8:125328150-125328172 CTGTTAAAAAAAAAAAAAAAAGG - Intronic
1047895746 8:129364684-129364706 CTGTTAAATATGTGAGCAAAAGG - Intergenic
1048189521 8:132275414-132275436 CTGTAAAATGACATAGAAAGGGG + Intronic
1048513349 8:135081826-135081848 CTGTTAAACAAGAAACAAACTGG + Intergenic
1048717229 8:137283380-137283402 CAGTTACATGAGAGAGAAAAAGG - Intergenic
1049906580 9:222907-222929 CTTTTAAATAAAATAGCAAATGG + Intronic
1050266868 9:3900182-3900204 CTGTTAAAAAAAAAAAAAAAAGG + Intronic
1050588451 9:7137991-7138013 CTTTTAAATAAGGTACAAAAAGG - Intergenic
1050907108 9:11018188-11018210 CTGTTTATAAATATAGAAAAAGG - Intergenic
1050938983 9:11435354-11435376 CTGCTAGATAAGGTAGAAGAGGG - Intergenic
1051063853 9:13077521-13077543 CTGCTATAAAAGATAAAAAATGG + Intergenic
1051521575 9:17995080-17995102 CTGTTAAGTAAACAAGAAAATGG - Intergenic
1051766617 9:20531456-20531478 CTTTTAAAAAAGATAAAAATAGG - Intronic
1052085557 9:24261273-24261295 CTGATAGATAATATATAAAATGG + Intergenic
1052139620 9:24963564-24963586 CTGTTTCATAAGATGGCAAAGGG + Intergenic
1052466113 9:28831437-28831459 TTCTAAAATAAAATAGAAAATGG - Intergenic
1052723598 9:32202500-32202522 CTTTTAAAAAGTATAGAAAAGGG + Intergenic
1053081441 9:35181212-35181234 CTGTGAAATAAGAAAAATAAGGG - Intronic
1053169286 9:35867436-35867458 GTGTTAAACAAGAGAGAGAATGG + Intergenic
1053449519 9:38181314-38181336 CTGCTGAATGTGATAGAAAAAGG + Intergenic
1053640984 9:40079999-40080021 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
1053765152 9:41385469-41385491 TTTTTAAAGAAGAAAGAAAAAGG + Intergenic
1054543768 9:66296631-66296653 TTTTTAAAGAAGAAAGAAAAAGG + Intergenic
1054880707 9:70141964-70141986 CTTTTAAGTATAATAGAAAAGGG + Intronic
1054909442 9:70440726-70440748 CTGTTAACTAAAATAAAAAAGGG + Intergenic
1055194467 9:73571088-73571110 TTGTCAAATAAGACATAAAATGG + Intergenic
1055436291 9:76295405-76295427 CTCTTAGGTAAGTTAGAAAATGG + Exonic
1055528339 9:77157699-77157721 GTCTTAAATAATATTGAAAAGGG + Intergenic
1055833587 9:80412409-80412431 GTTTTACATAAGATAGAAAAAGG + Intergenic
1055925310 9:81504213-81504235 AGGATAAATAAGAAAGAAAAAGG - Intergenic
1056112856 9:83412987-83413009 CTGTCAAAAAAAATAAAAAAAGG + Intronic
1056408936 9:86305919-86305941 TTGTTAAATAACCCAGAAAATGG + Intronic
1056653940 9:88493959-88493981 CTCTAAAAGAAGATATAAAATGG + Intergenic
1056936885 9:90921810-90921832 CTGTTCAAAAAGCAAGAAAAAGG + Intergenic
1058166891 9:101629878-101629900 CTTTGAAATAAGATAGACATGGG - Intronic
1058364657 9:104194771-104194793 GGTTTAAATAAAATAGAAAATGG - Intergenic
1058942791 9:109829645-109829667 CTGATAAAGAAGAGAGAGAAAGG - Intronic
1059486081 9:114627841-114627863 ATTTTAAATAAAACAGAAAAAGG - Intronic
1060079991 9:120634884-120634906 CTGTTAGAAAAGATGGACAAAGG - Intronic
1060182605 9:121544835-121544857 CTGTTAAAAAAAAAAAAAAAAGG + Intergenic
1060500701 9:124151849-124151871 CTGTTAAAAAAAAGAAAAAAAGG - Intergenic
1061722921 9:132564802-132564824 CTTTCAAATGAGTTAGAAAATGG + Intronic
1202788754 9_KI270719v1_random:63074-63096 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
1185956697 X:4498634-4498656 ATGTTCAATAAGAGACAAAATGG - Intergenic
1186020413 X:5248480-5248502 CTGATAAATAAGAATGAATAGGG - Intergenic
1186126612 X:6421169-6421191 CTGTTTACTGAGACAGAAAATGG - Intergenic
1186672716 X:11783135-11783157 CTGTTAAGTGAGATACCAAAAGG + Intergenic
1186683003 X:11895587-11895609 CAGTTAAATGAGATGGAAATGGG + Intergenic
1187681679 X:21773752-21773774 CTGTTCCACAAGATAGAGAAAGG + Intergenic
1187810750 X:23174162-23174184 CTGTTAATTTAGAAAGAAAATGG + Intergenic
1188875237 X:35421705-35421727 TTGTTAATTAATATATAAAATGG + Intergenic
1189261476 X:39682013-39682035 CTTCTAAATAAGACACAAAATGG - Intergenic
1190419399 X:50213544-50213566 CTCTTCCATAAAATAGAAAAGGG - Intronic
1190853465 X:54269195-54269217 CTGTCAAGAAAGACAGAAAAAGG + Intronic
1191588291 X:62852505-62852527 CTGATAAATAGTATAGCAAATGG - Intergenic
1192282644 X:69701702-69701724 CAGTTAAACGAGAGAGAAAAAGG + Intronic
1192548574 X:72034464-72034486 CTCTTACAGAAAATAGAAAAGGG - Intergenic
1192899690 X:75483293-75483315 TTGTTAAAAAAGAGAAAAAATGG + Intronic
1193201828 X:78700300-78700322 CTGGAAAATAAGAAAGCAAATGG - Intergenic
1194137939 X:90170941-90170963 CTATTCAATAATATAAAAAATGG + Intergenic
1194300938 X:92185056-92185078 ATGTTAAATTACATAGCAAAAGG - Intronic
1195266143 X:103182015-103182037 CTGTAAAATTAGAATGAAAAAGG - Intergenic
1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG + Intronic
1195505182 X:105648219-105648241 CTGCTAGATAATATACAAAAGGG + Intronic
1195559861 X:106270901-106270923 CTTTTGAACAAAATAGAAAAAGG + Intergenic
1195562100 X:106295438-106295460 CTTTTGAACAAAATAGAAAAAGG - Intergenic
1195570967 X:106398083-106398105 CTCTTGAATAAGACAGTAAATGG - Intergenic
1195777377 X:108422359-108422381 CTGTCTAAAAAGAAAGAAAAAGG + Intronic
1195788583 X:108556244-108556266 GTATTAAATAAGATAAAACATGG + Intronic
1196769803 X:119282120-119282142 CTGTGAGAGAAGAAAGAAAATGG - Intergenic
1196935595 X:120727546-120727568 ATGTACAATAAGAAAGAAAATGG + Intergenic
1197473080 X:126886683-126886705 CTGATAAAGAACAAAGAAAAAGG + Intergenic
1198076233 X:133195722-133195744 CTGTTAAAAAATATAGAAAAGGG + Intergenic
1198802284 X:140460147-140460169 CTGTTACAAAAGAAAGGAAAGGG - Intergenic
1199056587 X:143303525-143303547 CTTTTAAATATGATAAAGAAGGG + Intergenic
1200483731 Y:3741197-3741219 CTATTCAATAATATAAAAAATGG + Intergenic
1201493531 Y:14568493-14568515 TTTTTAAATAAGAAAGAAATAGG - Intronic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic
1202187810 Y:22206415-22206437 CTGATAAAAAAAATAAAAAAAGG + Intergenic
1202203550 Y:22379981-22380003 CTGATAAAAAAAATAAAAAAAGG - Intronic
1202594878 Y:26527765-26527787 ATATTACATAAAATAGAAAAAGG - Intergenic