ID: 1195379041

View in Genome Browser
Species Human (GRCh38)
Location X:104254252-104254274
Sequence TGGGGGCTGTGGTCCCTCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195379030_1195379041 26 Left 1195379030 X:104254203-104254225 CCTGCAGCTGAAACTGCGTGAAC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1195379041 X:104254252-104254274 TGGGGGCTGTGGTCCCTCAGCGG 0: 1
1: 0
2: 5
3: 29
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195379041 Original CRISPR TGGGGGCTGTGGTCCCTCAG CGG Exonic
900103608 1:973071-973093 TGGGGACCCTGGTTCCTCAGGGG + Intronic
900290590 1:1922002-1922024 TGGGGGCTGGGGGCTCTGAGGGG + Exonic
900395483 1:2451630-2451652 CGGGGGCTCTGACCCCTCAGAGG + Intronic
900954755 1:5879669-5879691 TGGGGCCTGTGGGTCCACAGGGG + Intronic
900997608 1:6130830-6130852 TGGGGGCTGTGGTCAGTCCCAGG - Intronic
902273787 1:15325214-15325236 TGAGGAATGTGGTCCCCCAGGGG + Intronic
902617999 1:17634469-17634491 TGGGGGCTGTGACCCCGCTGGGG - Intronic
903277601 1:22231792-22231814 TGGGGACTGTGTTTCCTCTGAGG - Intergenic
903864523 1:26388606-26388628 TGAGGGCTGGGGACCCTCAGAGG - Intergenic
904006464 1:27365902-27365924 GCGGGGCTGTGGTGTCTCAGGGG - Intronic
904935117 1:34124629-34124651 AGGGGTCTGTGCTCCCCCAGTGG + Intronic
905872429 1:41412791-41412813 TTGGGGCAGTGGACCTTCAGGGG + Intergenic
906955687 1:50371691-50371713 GGCTGGCTGTGGTCCCTGAGTGG - Intergenic
907970451 1:59375783-59375805 TGGGTTCTGTTGTCCCACAGTGG + Intronic
908682811 1:66681758-66681780 TGGTGTCTGAGGTGCCTCAGTGG - Intronic
909329332 1:74393725-74393747 TGGGGGATGGGGGCCCTGAGGGG + Intronic
912459892 1:109823634-109823656 TAGGGGCAGTGGACCCACAGTGG + Intergenic
912472398 1:109914687-109914709 TGAGGTCTGCTGTCCCTCAGTGG + Intronic
914337053 1:146724880-146724902 AGGGGGCTATGGACACTCAGAGG + Intergenic
915081651 1:153356899-153356921 TGGGCCCTGTGTTCCCACAGTGG + Intergenic
921149200 1:212386349-212386371 TGGGGTGTCTGGTCCCTGAGTGG - Intronic
922041487 1:221902765-221902787 TGTGGTGTGGGGTCCCTCAGTGG - Intergenic
922087955 1:222369103-222369125 TGGGATCTGGGGTCCCTCATAGG + Intergenic
922703915 1:227779006-227779028 TGGGGGCTGAGGTCACTCACAGG - Intronic
923267764 1:232330967-232330989 TAGGGGGTGTGGCTCCTCAGTGG - Intergenic
924258064 1:242202276-242202298 TTGGGTGTGTGGTCCCTAAGTGG + Intronic
1063133404 10:3197102-3197124 TGGGGGCTGTGTTCACCCCGGGG + Intergenic
1066656692 10:37703988-37704010 GGGGGGCTGTGATCCCTCCAGGG - Intergenic
1067041216 10:42954245-42954267 GGGGGGCTGTGATCCCTCCAGGG - Intergenic
1067561514 10:47307971-47307993 TGGAGGCTGTTGTCCCTGTGAGG + Intronic
1069745636 10:70713288-70713310 TGGGTGCTGTGCTACCTCTGTGG + Intronic
1069934328 10:71904943-71904965 CGGGGACTGTGTTACCTCAGGGG + Intergenic
1070806782 10:79275394-79275416 CAGGGGCTGTGGTCCCCAAGAGG - Intronic
1070917101 10:80161908-80161930 GGCAGGCTGGGGTCCCTCAGAGG - Intronic
1071202250 10:83232187-83232209 TGGGGGTTGTGATCACTCAGTGG + Intergenic
1072205901 10:93205114-93205136 TCGGGGCTGTGCTACCTCTGAGG + Intergenic
1073605865 10:104895069-104895091 TGTGGGCTGTGGACACTCAGGGG + Intronic
1074412600 10:113241416-113241438 TGAGAGCTGTGGTCACCCAGAGG + Intergenic
1074919580 10:117993503-117993525 TGGGGGGAGTGTTCCATCAGGGG - Intergenic
1075741317 10:124698174-124698196 TGGGGGCCGGGGTTCCCCAGGGG - Intronic
1075966039 10:126612516-126612538 TGGGTGATGGGGTACCTCAGCGG - Intronic
1076046313 10:127296890-127296912 TGTGAGCTGTGGCCCATCAGTGG + Intronic
1076308840 10:129487256-129487278 TGGTTGCAGTGGTTCCTCAGAGG + Intronic
1076427833 10:130380175-130380197 TGGGTGCTGTGGTCCCAGGGAGG - Intergenic
1076733140 10:132448071-132448093 TGGCGGCTCTGGGCCCTCAAGGG + Exonic
1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG + Intronic
1077160122 11:1108857-1108879 TCAGGGCTGTGCTCCCTCGGAGG + Intergenic
1077185931 11:1235359-1235381 TGGTGCCGGTGGTCCCACAGGGG - Exonic
1077297274 11:1832108-1832130 TGGGGGCTGGGGGCCCTAACGGG + Intronic
1077661475 11:4072259-4072281 TGTGGGCTCTGGACACTCAGAGG - Intronic
1078250831 11:9615060-9615082 TGGGGGCTTCGGGCCCTCAAGGG - Intergenic
1078463957 11:11536443-11536465 AGGTGGCTCTGGACCCTCAGAGG + Intronic
1079130755 11:17745585-17745607 TGGGGTCTGGGCTTCCTCAGAGG + Intronic
1082784020 11:57306925-57306947 GGGGGGCAGTGGTCCCACAGTGG + Intronic
1083686801 11:64381392-64381414 TTGCTGCTCTGGTCCCTCAGAGG - Intergenic
1083777998 11:64903538-64903560 CCGGGGCGGTGGTCCCTCAGAGG + Intronic
1083780299 11:64914118-64914140 CAGGGGCTGTGGTGGCTCAGAGG + Exonic
1084179191 11:67438138-67438160 TCGGGGAGATGGTCCCTCAGAGG + Exonic
1084459914 11:69290998-69291020 TTGGAGCTGTGGTCCCTCCTTGG + Intergenic
1084496098 11:69504562-69504584 TGGAGGCTGGGGTCCCCAAGTGG - Intergenic
1084501827 11:69539758-69539780 GGGGGGCTTCGGGCCCTCAGGGG - Intergenic
1084803913 11:71565830-71565852 AGGGGGCTGTGGTTCCTGTGGGG + Exonic
1088364993 11:109031167-109031189 TGGGGGCTGTGGAACCAGAGGGG + Intergenic
1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG + Intronic
1090270187 11:125380599-125380621 TGGAGGATGTGGACCCACAGTGG + Intronic
1090693740 11:129215149-129215171 TGGGGGTTGTGGTCACCCTGTGG - Intronic
1091509965 12:1112324-1112346 TGTGTGCAGTGGTCCCACAGTGG + Intronic
1091699607 12:2651088-2651110 TGGGGCATGAGGTCCTTCAGGGG + Intronic
1092246880 12:6868638-6868660 TGAGGGCCGTGGCCTCTCAGGGG + Intronic
1092290912 12:7158991-7159013 TGGAGGCTCTGGGGCCTCAGGGG + Intergenic
1096193671 12:49635397-49635419 TCTGGGCTGTGGTCCCTGAGAGG + Exonic
1101652570 12:106690786-106690808 TGGGGAGTGTGGTCCCTCACTGG + Intronic
1102231924 12:111268595-111268617 TGCAGGCTGTGGTCCCTGCGAGG + Intronic
1103730374 12:123023221-123023243 TGAGGGCTGTGCTCCCTGTGAGG + Intronic
1104048543 12:125181261-125181283 TGGGCACTGTGGTGCCTCATGGG + Intergenic
1104391809 12:128397264-128397286 TGAAGGCTTTGGTCCCACAGAGG + Intronic
1104652587 12:130546943-130546965 TGGGGGTTGTGGTGGGTCAGTGG - Intronic
1105026461 12:132852579-132852601 TGGGGTCCTGGGTCCCTCAGTGG - Intronic
1105634912 13:22207820-22207842 TGGGTCCTGTGGACCCTGAGAGG + Intergenic
1105823366 13:24099596-24099618 GGGGGGCTGTGGGCCCTCCCCGG - Intronic
1107861423 13:44664699-44664721 TGGGGGCAGGGGTCCCAGAGGGG + Intergenic
1108583774 13:51849885-51849907 TGCCGTCTGTGGTCTCTCAGTGG + Intergenic
1112183183 13:97104885-97104907 TGGTGGCTGGGGTCCCTAAATGG - Intergenic
1112733061 13:102388471-102388493 TGTGGACTGTGGTGCCTCATGGG - Intronic
1113316567 13:109186358-109186380 AGGGTGCTGTGGTGCCTCAGGGG + Intronic
1113462315 13:110490929-110490951 TCGGAGCTGTGGTCCCACAATGG + Intronic
1113743880 13:112729346-112729368 AGGGGACTGTGCTGCCTCAGTGG - Intronic
1113857799 13:113458326-113458348 AGGGGGCTGTGGGCTCACAGTGG + Intronic
1117991283 14:61436316-61436338 TGTGGGCTGAGATTCCTCAGAGG + Intronic
1118734330 14:68691016-68691038 TGGGGGCTGCGGCCCCTCCATGG - Intronic
1118822684 14:69355389-69355411 GGTGGGCTGTGCTCCCTGAGAGG - Exonic
1120247364 14:82022948-82022970 TTGGTGCTCTTGTCCCTCAGAGG - Intergenic
1122370918 14:101228581-101228603 TGGGGGCTGTGAGGCCCCAGAGG - Intergenic
1123716378 15:23035782-23035804 TGGGGGCTGTGGACACAGAGGGG + Intronic
1123935131 15:25190403-25190425 TGGGGGCAGTGCGGCCTCAGTGG + Intergenic
1127275345 15:57438765-57438787 TGTGGGCTGTGGGCAGTCAGGGG - Exonic
1127331972 15:57948570-57948592 TGGAGGCTGTAGTCCCAAAGAGG - Intergenic
1127640969 15:60915385-60915407 TGGGGCCTGTGCCCCCCCAGTGG - Intronic
1128673241 15:69590273-69590295 TGTGGGCTGAGGTCCCTCAGTGG - Intergenic
1128760520 15:70213516-70213538 CGGGGGCTTTGGTCACACAGGGG - Intergenic
1129325432 15:74798038-74798060 TGAGGGCTGAGGACCCCCAGGGG - Intronic
1129332865 15:74836734-74836756 TGGGGAGGGTGGTCCCTGAGGGG + Exonic
1129465660 15:75722866-75722888 TGAGGCCTGTGGTCCCTCAGGGG + Intergenic
1131110237 15:89760341-89760363 TGGGAGCTGCGGAGCCTCAGCGG - Intergenic
1132628199 16:902380-902402 GGGACGCTGTGTTCCCTCAGTGG - Intronic
1133175978 16:4014908-4014930 AGGGGAATGTGGTCACTCAGGGG - Intronic
1134530478 16:14979005-14979027 TGGGGGCAGTTGTCCCCCAAGGG + Intronic
1136005899 16:27328672-27328694 TGGGGCTTGTGGTCTCTCAGAGG + Intronic
1137222864 16:46472946-46472968 TGGTGGCTTTGGATCCTCAGTGG + Intergenic
1138155779 16:54701738-54701760 TGGGGGCTTTGGGGCTTCAGAGG + Intergenic
1139275096 16:65720015-65720037 TGGGGCCTGTGCATCCTCAGTGG - Intergenic
1139464773 16:67148636-67148658 TGGAGGCTGTATCCCCTCAGAGG - Exonic
1139470956 16:67177985-67178007 GAGGGGCTGTGGACCTTCAGAGG - Intronic
1139865867 16:70061962-70061984 TGGGGGCAGTTGTCCCCCAAGGG - Intergenic
1139997217 16:70992439-70992461 AGGGGGCTATGGACACTCAGAGG - Intronic
1141575378 16:84959985-84960007 GTGGGGCTGTGCTCCCTCTGGGG - Intergenic
1141841132 16:86574816-86574838 CGTGGGCTGTGGTCCCTGTGCGG + Intergenic
1142362183 16:89632715-89632737 TGGGGCCTCTGGTTTCTCAGTGG - Intronic
1142433549 16:90043351-90043373 TCTGGGCTGTGGCCCCCCAGGGG - Exonic
1143361551 17:6375405-6375427 TGGGGGCTTTCTTCCCTCAGTGG - Intergenic
1143576838 17:7798772-7798794 TGGGAGCTGTGGTCCTTCTGGGG - Intronic
1143697349 17:8630419-8630441 TGGGGGCACTGGGACCTCAGTGG - Intronic
1144772496 17:17767663-17767685 TGTGTGCTGTGATCCTTCAGGGG + Intronic
1144955153 17:19015376-19015398 TGAGGGCTGTGATCACACAGAGG - Intronic
1145808509 17:27751260-27751282 TGGGGCCTGTAGGCCCTGAGTGG - Intergenic
1146183600 17:30711371-30711393 TGAGGGGTGTGGACCCTCCGCGG - Intergenic
1148164929 17:45476789-45476811 TAGGGACTGTGGTAGCTCAGAGG - Intronic
1149296541 17:55266172-55266194 TGGGGGGAGTGGTCTCTCGGCGG + Intronic
1149797986 17:59539338-59539360 TGGGGGCTGTGACCTCACAGAGG + Intergenic
1150396147 17:64823452-64823474 TAGGGACTGTGGTAGCTCAGAGG - Intergenic
1151726922 17:75890803-75890825 CAGGGGCTGTGTTCCCTCTGGGG - Exonic
1151765544 17:76131653-76131675 TGGGGGCTGTGATGCTTCAAAGG + Intergenic
1152043901 17:77923598-77923620 AGGGGGCTGGGGTACCCCAGGGG - Intergenic
1152132734 17:78486714-78486736 TGGGGGCTGTGCCCTCTCTGGGG + Intronic
1152716418 17:81902768-81902790 TGGGGGCGGGGGGCCCCCAGCGG - Exonic
1152875199 17:82782463-82782485 TGGAGCCTGTGGTCCCTCTGAGG + Intronic
1152902358 17:82950180-82950202 TGGGGGCTCTGGGCCCTCCAAGG + Intronic
1153780939 18:8494596-8494618 TTGGGGCTGTGGCACCCCAGTGG + Intergenic
1153913065 18:9720984-9721006 TGGGGTCCGTGGTCCATCATGGG + Intronic
1154286159 18:13058687-13058709 TCAGGGCTGTGGGACCTCAGCGG + Intronic
1155175914 18:23300883-23300905 TGGAGGCTTCGGTCCCTCATAGG - Intronic
1160622410 18:80180406-80180428 TGGGGGCTGTGGCCTCACAGAGG + Intronic
1160660268 19:294962-294984 TGGGGTCTGTGGGTGCTCAGTGG - Intergenic
1160727731 19:625025-625047 TGGGGGCTGGGGACCCCCAGAGG - Intronic
1160730273 19:638929-638951 TGGGAGCTGTGTCCCCACAGCGG + Intergenic
1161550914 19:4911595-4911617 TGGGGCGTGTGGTCCCCGAGGGG + Intronic
1162975192 19:14204368-14204390 TGAGGGGTGTGGACCCTCCGTGG + Intronic
1162997071 19:14342971-14342993 TGGAGCCCGTGGTCCCCCAGAGG - Intergenic
1163146059 19:15379936-15379958 TGGGAGTTGTGGTCCCACCGCGG + Intergenic
1163521807 19:17795940-17795962 TAGGAGCTGTGGCCACTCAGTGG + Intronic
1163797699 19:19346834-19346856 GGGGAGCTGTTGTCCCACAGGGG - Intronic
1164204430 19:23046066-23046088 TGGGGACTGTGTCCCCTTAGTGG + Intergenic
1165346160 19:35249819-35249841 TGGGGGCTTTAGTCCCTCCATGG + Intronic
1166198573 19:41221838-41221860 TAGAGGCTGGGGTCCCTCTGAGG - Intronic
1167593645 19:50416866-50416888 TGGGGGCCGAGGACCCTCTGTGG - Intronic
1167643327 19:50693706-50693728 GGGGGGCTGGCGTCCCTCTGTGG - Intronic
1167763316 19:51462691-51462713 TGGGTGCTGTGATCCCTCCAGGG - Intergenic
1168281217 19:55306367-55306389 GGAGGGCTCTGGACCCTCAGAGG - Exonic
925905982 2:8539850-8539872 AGGAGGCTGGGGTCCCCCAGTGG - Intergenic
926596621 2:14797131-14797153 AGGTGGCTGTAGTCCCCCAGTGG - Intergenic
927187474 2:20492189-20492211 TGGGTGCTCTGATCCCTCTGTGG + Intergenic
927225818 2:20765616-20765638 TGTGGGCTGGGGTCACTCATTGG + Intronic
928224537 2:29436894-29436916 TCGGGCCTGTGCTCCCTAAGTGG - Intronic
929044472 2:37776583-37776605 TGGGGGCTTTGGTACAGCAGGGG + Intergenic
932733750 2:74239636-74239658 GGGGGGCTGGGGTCCCTCAGAGG - Intronic
937908335 2:127063532-127063554 GGTGGGGTGTGGCCCCTCAGAGG + Intronic
938068550 2:128294566-128294588 TGGGAGCTGCGGCCCCTCTGAGG + Intronic
938696526 2:133840258-133840280 GTGGGGCTGTGGCCCCTCACAGG - Intergenic
942783850 2:179676737-179676759 GGGGGGATTTTGTCCCTCAGGGG + Intronic
945043796 2:205764362-205764384 CGGGGGCTGTTGGCGCTCAGTGG + Intronic
946157215 2:217814881-217814903 TGGGCTCTGTGGTGCATCAGAGG - Intronic
947437508 2:230085218-230085240 TGGGGCCTGGGGACCCGCAGAGG - Intergenic
948542630 2:238701421-238701443 TGGGACCTGTGGCCCCACAGGGG - Intergenic
1168795680 20:609046-609068 TGGGGGCTGGGGACTCTCAGAGG + Intronic
1171367017 20:24632122-24632144 TGGGGGCTGTGGGCCCAGGGCGG + Intronic
1171452673 20:25247434-25247456 AGGGGGCTGCGGTCCCTCCGAGG + Intergenic
1172511681 20:35505081-35505103 TGGGCCCTGTGGCACCTCAGGGG + Intronic
1172867782 20:38113110-38113132 TGATGGATGTGGTGCCTCAGTGG + Intronic
1173619983 20:44429526-44429548 TGAGGGCTGTGGGGTCTCAGGGG - Exonic
1174035042 20:47663655-47663677 TGGGGTCACTGATCCCTCAGAGG - Intronic
1174792851 20:53496595-53496617 TGAGGGCTGTGGAAGCTCAGAGG + Intergenic
1175217942 20:57401261-57401283 TGGGGCGTGTGGTTCCCCAGAGG + Intronic
1175416562 20:58805121-58805143 GAGGGGCTGGGCTCCCTCAGGGG - Intergenic
1175460685 20:59149876-59149898 GGGGGGCTGTCGTCCCACACAGG + Intergenic
1175813598 20:61872231-61872253 TGGTGGCTGTAATCCCACAGAGG + Intronic
1175896040 20:62335961-62335983 TGGGGTGTGGGGTTCCTCAGGGG - Intronic
1175927026 20:62476007-62476029 AGGGGGCTGCGGAGCCTCAGCGG - Intergenic
1176098143 20:63353517-63353539 GGGGGGCTGTGGTCCTAGAGGGG + Intronic
1176098176 20:63353602-63353624 AGGGGGCTGTGGTCCTAGAGGGG + Intronic
1176098183 20:63353620-63353642 AGGGGGCTGTGGTCCTGGAGGGG + Intronic
1176098247 20:63353802-63353824 AGGGGGCTGTGGTCCTGGAGGGG + Intronic
1176169164 20:63689344-63689366 TGGGAGCTGTGGACCCCAAGTGG + Intronic
1176172267 20:63701367-63701389 CGGGGGCAGTGGCACCTCAGAGG + Intronic
1178268555 21:31167934-31167956 TGAGGGGTGTAGCCCCTCAGGGG - Intronic
1179094493 21:38300048-38300070 TGGGGTGTGAGGTCTCTCAGGGG - Exonic
1179425482 21:41274995-41275017 TGTGGGTTGTGCTTCCTCAGTGG - Intronic
1179714024 21:43278645-43278667 TGGGGTCTGTGGGGACTCAGTGG - Intergenic
1180905463 22:19407835-19407857 TGGAGGCTCTGGCCCATCAGGGG - Intronic
1180988112 22:19917505-19917527 AGGGGACAGTGGTCCCGCAGAGG - Intronic
1181031579 22:20150776-20150798 AGGGGGCAGTGGGCCCACAGTGG - Exonic
1181055293 22:20258075-20258097 TGGGGATGGTGGTCCCTCCGGGG - Intronic
1181428172 22:22857281-22857303 TGTGTGTTGTGGTCCCTGAGTGG + Intronic
1182483187 22:30622913-30622935 AGGTGGCTGTTGTCCCTAAGGGG - Intronic
1182698143 22:32209993-32210015 TGGGGAGTTTGGCCCCTCAGAGG + Intergenic
1184276166 22:43411007-43411029 AAGGGGCTGTGGCTCCTCAGAGG - Intergenic
1184464929 22:44663346-44663368 GTGGGGCTGTGCTCCTTCAGGGG + Intergenic
1184835664 22:47019597-47019619 TGGGGGCTGTGGGCAGGCAGGGG + Intronic
1184903919 22:47465914-47465936 TGTGGGCTGGTGCCCCTCAGGGG + Intronic
1185094998 22:48801334-48801356 TGGGGGCTGTGGTGTCGCATGGG - Intronic
1185107947 22:48884996-48885018 AGGGAACTGTGGTGCCTCAGAGG - Intergenic
1185108012 22:48885274-48885296 TGGGGGGAGTGGGCCCTGAGGGG + Intergenic
1185141001 22:49101292-49101314 TGCAGCCTGGGGTCCCTCAGAGG - Intergenic
1185219288 22:49621440-49621462 TCGGGGCTGTGGGCCCTCGGGGG + Intronic
1185294577 22:50046848-50046870 AGGGGGCTGTGGGACCCCAGGGG - Intronic
949169371 3:980426-980448 TGGGGGATGGGGTACCTGAGAGG + Intergenic
949982353 3:9509686-9509708 TGGTGGCTGTGGGGCCCCAGAGG + Intronic
950463503 3:13139478-13139500 TAGGGACTGTGGCCCCTCAGGGG - Intergenic
951544422 3:23810615-23810637 TGGGGTCTGTGGTGCCCGAGTGG + Intronic
954633406 3:52058809-52058831 TGGGGGCTGGGGAGGCTCAGAGG - Intergenic
954689991 3:52390695-52390717 TTGGGCCTGTGCTCTCTCAGGGG + Intronic
956191229 3:66610315-66610337 TGGGGTCTGTGGCCTCCCAGTGG + Intergenic
961155462 3:124675973-124675995 TGGGGGCTATTGTGCCTTAGGGG - Intronic
961334065 3:126159726-126159748 TGGGGTCAGTGGTCACTTAGTGG + Intronic
961821993 3:129579871-129579893 TTTGGGCTGGGGTCCCTGAGGGG - Intronic
966326038 3:178755502-178755524 GGGTGGCTATGGTCCCACAGAGG - Intronic
968427452 4:533271-533293 CAGGGGCTGTGCTCCCCCAGTGG + Intronic
968458699 4:713028-713050 TGGGGCCTGTGGGCCCTGTGGGG + Intronic
968653534 4:1769206-1769228 TGGGGCCTGTGGGGCTTCAGGGG + Intergenic
968902048 4:3436476-3436498 TGGGGGACGGGGTCCCTCGGGGG + Intronic
968903674 4:3442331-3442353 TGGGGGCTGTCATCCCTGTGCGG + Intronic
969274404 4:6125174-6125196 TGGGGACTGTGGTGCCTATGTGG - Intronic
969321957 4:6417770-6417792 TGGGGGGCATGGTCACTCAGAGG + Intronic
970143704 4:13010652-13010674 TTGGGGCTGTGCTCCCTCTGGGG + Intergenic
971479557 4:27102186-27102208 TGGCGACTGTGCTCCATCAGTGG + Intergenic
974061794 4:57042123-57042145 TGGGGGGTGTGTTCCCTAATTGG - Intronic
976213285 4:82692797-82692819 TGAGGGCTGCTGTTCCTCAGCGG - Intronic
981028477 4:140100046-140100068 TGGGGGCTGCGGTCGTTCAAGGG - Intronic
982015376 4:151148114-151148136 TGGGGGAGGTGGTCTCTCAGGGG + Exonic
985641807 5:1066937-1066959 TGGTGGCTCTGATCCCTGAGTGG - Intronic
985652645 5:1114024-1114046 TGCTGGCTGTGGACCTTCAGAGG + Intergenic
985720290 5:1485327-1485349 TGGGTGCTGCTGACCCTCAGGGG - Intronic
985779761 5:1864293-1864315 AGGTGGCTGTGGTCACGCAGTGG - Intergenic
985967597 5:3349347-3349369 TGTGGGCTGTGGATTCTCAGAGG + Intergenic
986965865 5:13270201-13270223 TGGTTGGTGTGGTCTCTCAGAGG - Intergenic
989743170 5:44795693-44795715 TTGGGGCTGCAGTCTCTCAGCGG - Intergenic
991653827 5:68883218-68883240 TAGGGCCTGTGGTCCCTCAGAGG + Intergenic
992228896 5:74644083-74644105 TGGGAGGTGTGGTCCCTGACTGG - Intronic
994027399 5:95100683-95100705 TAGGTGCTGTGGCCTCTCAGGGG - Intronic
995387482 5:111603860-111603882 TGGAGGCTGTAGTCACTGAGAGG + Intergenic
997045982 5:130317919-130317941 TGAGGGCATTGGTGCCTCAGTGG + Intergenic
997362990 5:133306839-133306861 GGGAGCCTGTGGTCCCTGAGGGG + Intronic
998367399 5:141640084-141640106 CTGGGGCTGTGGCCTCTCAGGGG - Exonic
1000137662 5:158368361-158368383 TGGGAGCTGTGGTCCCTTTAGGG + Intergenic
1001020086 5:168175416-168175438 TGAGTGCTGTCTTCCCTCAGAGG + Intronic
1001311955 5:170617461-170617483 TGGAGGGTGAGGTCCCTCAGTGG - Intronic
1002021847 5:176368667-176368689 TGGGGGCTGTGGGCAGTGAGCGG + Intronic
1002021865 5:176368705-176368727 TGGGGGCTGTGGGCAGTGAGCGG + Intronic
1002021883 5:176368743-176368765 TGGGGGCTGTGGGCAGTGAGCGG + Intronic
1004303191 6:14476778-14476800 GGAGGGCTCTGCTCCCTCAGTGG + Intergenic
1004526446 6:16412900-16412922 TGGGGGCTGTTGTCTCTCTTGGG + Intronic
1006641567 6:35492125-35492147 TGGGGGCTGGGGTCCCTGCAGGG - Intronic
1007371349 6:41428425-41428447 AGGGGGCGGGGGTCCCTCCGCGG - Intergenic
1007784566 6:44272307-44272329 AGGGGGCTGGGGTCCCTGAGCGG - Intronic
1007837291 6:44683479-44683501 TGGAGGCTGTGGTGACTCAGTGG + Intergenic
1014552157 6:122801494-122801516 TGGGGGCTGTGCTCCAGAAGTGG - Intronic
1017235154 6:152111153-152111175 TGTGGGCTGTGGTCCCTTCCTGG - Intronic
1018430670 6:163719329-163719351 TGGAGGCTGTGTTCCCACACTGG + Intergenic
1018855012 6:167668999-167669021 TGTGGGCTTTGGTTGCTCAGGGG - Intergenic
1019289900 7:245360-245382 TGGGGGCTGAGTTCCCTCCCTGG + Intronic
1019682252 7:2357249-2357271 TGACGGCTGTGGGTCCTCAGCGG + Intronic
1019731693 7:2632520-2632542 GGGGGGCCGTGGACCCTCACTGG - Intronic
1019852490 7:3573509-3573531 TGGAGGCTGTTGTTTCTCAGGGG - Intronic
1020582295 7:10018309-10018331 TGGTGGCTGACTTCCCTCAGAGG - Intergenic
1023988593 7:45113312-45113334 CTGGGGCTGTGGTCACTCATTGG + Intergenic
1026879710 7:73900764-73900786 TGGGGGCTGCTGTTCCTCATTGG - Intergenic
1028242063 7:88433699-88433721 TGGGGGCTCTGGACCCTCACTGG + Intergenic
1029604428 7:101590145-101590167 TGGGGGCTGCAGTCACTCATGGG + Intergenic
1033115398 7:138620497-138620519 TGGGGGTCGTGGTTCCTCAGAGG - Intronic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1034275892 7:149823741-149823763 TGGGGGCTGCATTCCCCCAGAGG + Intergenic
1034469201 7:151246643-151246665 TGGGGGCTGTGGAGACTGAGAGG + Intronic
1034996135 7:155578263-155578285 TGTGTGCTGTGGGCCCGCAGCGG - Intergenic
1035016303 7:155769424-155769446 GGGGGGCTGCCGTCCCCCAGAGG + Intronic
1035024566 7:155817389-155817411 TGGAGGCTGGGGTGCCTCGGAGG + Intergenic
1035050904 7:155998616-155998638 TTGGAGCTGTGGGGCCTCAGAGG + Intergenic
1035051550 7:156001683-156001705 TGGGTGCCGCGGTCCCGCAGTGG + Intergenic
1036762807 8:11522464-11522486 AGTGGGCTATGTTCCCTCAGTGG - Intronic
1038132150 8:24744621-24744643 TGGGGGCTTTGGTAGCCCAGGGG - Intergenic
1039607930 8:38898428-38898450 TGGGGGTGGGGGTCCCTCTGAGG + Intergenic
1041698105 8:60759095-60759117 TGTGTTCTGTGGACCCTCAGGGG - Intronic
1041796127 8:61750694-61750716 TGGGGTCTGTGCTAGCTCAGGGG + Intergenic
1042485237 8:69340029-69340051 TGGGGGCTGTGGGACCTCAGGGG - Intergenic
1043938779 8:86173525-86173547 GAGGGGCTGTGATCCTTCAGAGG + Intergenic
1047298472 8:123591884-123591906 TTGGGGCTCTGCCCCCTCAGAGG + Intergenic
1047931094 8:129728777-129728799 TGGTGGCTCTGGTCCCACAGGGG + Intergenic
1049278870 8:141733954-141733976 TGGGAGCTCTGGGCCCCCAGGGG - Intergenic
1049411404 8:142475479-142475501 TGGAAGCTGTGGTCCCTGTGGGG + Exonic
1049424666 8:142532762-142532784 TGGGGCCTGTGGGCTCTCTGAGG + Intronic
1050766511 9:9141268-9141290 TAGGGTCTGTAGTGCCTCAGGGG - Intronic
1050981144 9:12017740-12017762 TTGGGGCTCTGGCCCCACAGTGG + Intergenic
1051935848 9:22441156-22441178 TGGGGGATGAGCTCCCTCTGGGG + Intergenic
1053270520 9:36746344-36746366 TGGGGGCTGGGGTGCAGCAGGGG - Intergenic
1058306022 9:103441559-103441581 TGTGGTCTGTGGACCCCCAGGGG - Intergenic
1059309298 9:113377240-113377262 TGCGGGCTGGGGAACCTCAGAGG - Intergenic
1060000427 9:119953439-119953461 TGGGGACTGTGGGCACACAGGGG - Intergenic
1060219353 9:121756117-121756139 TGGGGGCTGGGGGCTCTAAGAGG + Intronic
1060789508 9:126476404-126476426 TGGGCCCTGAAGTCCCTCAGAGG - Intronic
1061377807 9:130236413-130236435 AGGGGGCTGTGAGTCCTCAGAGG + Exonic
1061791985 9:133063787-133063809 TGGGAGGTGTGGTCCCTAGGGGG + Intronic
1062070786 9:134554012-134554034 TGGGGGCTGTCAGCCCTCGGGGG + Intergenic
1062463965 9:136673119-136673141 GGGGAGCTGTGGTCACTCACAGG - Intergenic
1185736780 X:2501288-2501310 TGGGGTCTGTGGTCCTGAAGGGG - Intronic
1189659003 X:43277951-43277973 AGGGGTCTGGGGTCCCTCACTGG - Intergenic
1192172490 X:68865579-68865601 TGGGGGCTGCACTCCCTCAGAGG + Intergenic
1195379041 X:104254252-104254274 TGGGGGCTGTGGTCCCTCAGCGG + Exonic
1199677481 X:150200304-150200326 TGAGGGCTGTGTTCCCAGAGGGG - Intergenic
1201077720 Y:10199737-10199759 TGGGTGCTGTGGGCCCACGGGGG + Intergenic
1201928651 Y:19317343-19317365 TGTAGGCTGGGGTCCCTCTGGGG - Intergenic