ID: 1195382671

View in Genome Browser
Species Human (GRCh38)
Location X:104285496-104285518
Sequence TCTATCAAAAAGACTCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195382671_1195382677 13 Left 1195382671 X:104285496-104285518 CCTAGCTGAGTCTTTTTGATAGA No data
Right 1195382677 X:104285532-104285554 CTAAAATTCAAGGGGCTGAGAGG No data
1195382671_1195382676 5 Left 1195382671 X:104285496-104285518 CCTAGCTGAGTCTTTTTGATAGA No data
Right 1195382676 X:104285524-104285546 AGTAAGAACTAAAATTCAAGGGG No data
1195382671_1195382674 3 Left 1195382671 X:104285496-104285518 CCTAGCTGAGTCTTTTTGATAGA No data
Right 1195382674 X:104285522-104285544 GGAGTAAGAACTAAAATTCAAGG No data
1195382671_1195382675 4 Left 1195382671 X:104285496-104285518 CCTAGCTGAGTCTTTTTGATAGA No data
Right 1195382675 X:104285523-104285545 GAGTAAGAACTAAAATTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195382671 Original CRISPR TCTATCAAAAAGACTCAGCT AGG (reversed) Intergenic
No off target data available for this crispr