ID: 1195383803

View in Genome Browser
Species Human (GRCh38)
Location X:104295067-104295089
Sequence ATATGGAGACTATACTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195383802_1195383803 -7 Left 1195383802 X:104295051-104295073 CCATTAAAAATCACAAATATGGA No data
Right 1195383803 X:104295067-104295089 ATATGGAGACTATACTGTTAAGG No data
1195383798_1195383803 9 Left 1195383798 X:104295035-104295057 CCAGGCTGGCCCATGACCATTAA No data
Right 1195383803 X:104295067-104295089 ATATGGAGACTATACTGTTAAGG No data
1195383800_1195383803 -1 Left 1195383800 X:104295045-104295067 CCATGACCATTAAAAATCACAAA No data
Right 1195383803 X:104295067-104295089 ATATGGAGACTATACTGTTAAGG No data
1195383799_1195383803 0 Left 1195383799 X:104295044-104295066 CCCATGACCATTAAAAATCACAA No data
Right 1195383803 X:104295067-104295089 ATATGGAGACTATACTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195383803 Original CRISPR ATATGGAGACTATACTGTTA AGG Intergenic
No off target data available for this crispr