ID: 1195386781

View in Genome Browser
Species Human (GRCh38)
Location X:104321106-104321128
Sequence CTGGATAAATAGACAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195386776_1195386781 12 Left 1195386776 X:104321071-104321093 CCGGACTGCTGTTGTTTTTAATC No data
Right 1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG No data
1195386779_1195386781 -10 Left 1195386779 X:104321093-104321115 CCTTCCATACTGGCTGGATAAAT No data
Right 1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG No data
1195386774_1195386781 18 Left 1195386774 X:104321065-104321087 CCGTGCCCGGACTGCTGTTGTTT No data
Right 1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG No data
1195386775_1195386781 13 Left 1195386775 X:104321070-104321092 CCCGGACTGCTGTTGTTTTTAAT No data
Right 1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195386781 Original CRISPR CTGGATAAATAGACAAAACA TGG Intergenic
No off target data available for this crispr