ID: 1195387930

View in Genome Browser
Species Human (GRCh38)
Location X:104330626-104330648
Sequence CTTGATAATAACTCTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195387929_1195387930 -4 Left 1195387929 X:104330607-104330629 CCAGTTAGTTTATCACACACTTG No data
Right 1195387930 X:104330626-104330648 CTTGATAATAACTCTTTTCCAGG No data
1195387928_1195387930 8 Left 1195387928 X:104330595-104330617 CCATTTCTTTTTCCAGTTAGTTT No data
Right 1195387930 X:104330626-104330648 CTTGATAATAACTCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195387930 Original CRISPR CTTGATAATAACTCTTTTCC AGG Intergenic
No off target data available for this crispr