ID: 1195389221

View in Genome Browser
Species Human (GRCh38)
Location X:104343689-104343711
Sequence GGGCAGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195389216_1195389221 3 Left 1195389216 X:104343663-104343685 CCACTTTCAATTACATGCAAATT No data
Right 1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG No data
1195389215_1195389221 4 Left 1195389215 X:104343662-104343684 CCCACTTTCAATTACATGCAAAT No data
Right 1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195389221 Original CRISPR GGGCAGGTTAATGCAAATTG AGG Intergenic